Clone Search


Resources for

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

Clones & Vectors for Gene Expression
  Promoter collection
  Epitope tag fusion clones
  SEREX cDNA clone
  HLA antigen cDNA clone
  Nakamura & White RFLP clone

Resources for Gene Analysis
  Cultured microbe
  Cultured animal cell
  Experimental animal
  in vitro experiment
  Plant gene resources

Clone Set & Library
  Genomic clone
  cDNA clone
  Expression clone

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vector for Recombinant Virus

Genomic DNA
  JCM Microbial Genomic DNA
  BRC Mouse Genomic DNA

Search for resources
  Key word search
  Depositors List
  Gene Set Collection

BRC News

Sequencing and PCR primers

Sequencing & PCR primers

Please contact DNA Bank for any commnets. Thank you.

Name of Primer Sequence Vector Purpose
T7long 5′-CGCCAAGCTCTAATACGACTCACTATAGGG-3′ T7 promoter sequence containing vectors
T7 5′-TAATACGACTCACTATAGGG -3′ pCMV_S-FLAG (RDB 5956) Sequencing 5′ of inserted DNA
SP6 5′-ATTTAGGTGACACTATAG -3′ pCMV_S-FLAG (RDB 5956) Sequencing 3′ of inserted DNA
pAxCAF1 5′-GGCTTCTGGCGTGTGACCGGC-3′ CAG promoter containing vectors Sequencing 5′ of inserted DNA
pAxCAR1 5′-CAGAGGGAAAAAGATCTCAGTGG-3′ CAG promoter containing vectors Sequencing 3′ of inserted DNA
pAxCALNLF1 5′-CACTGCATTCTAGTTGTGGTTTGTCC-3′ LNL (loxP) containing vectors Sequencing 5′ of inserted DNA
M13 5′-GTTTTCCCAGTCACGACGTTGTA-3′ pKM2L luciferase vector Sequencing 5′ of inserted DNA
phRLR2 5′-CCAATAGGTGCCTATCAGAAACGC-3′ pKM2L luciferase vector Sequencing 3′ of inserted DNA
7723km F 5′-AATTTCTGGAATGGGGTTCA-3′ Tth Disruption Plasmid Km toward insert
7723km R 5′-GATTGCGATGCTGATTCGT-3′ Tth Disruption Plasmid Km toward insert
BGHrev 5′- TAGAAGGCACAGTCGAGG -3′ BGHpA containing vector Sequencing 3′ of inserted DNA
pOTB7_F(7-32) 5′- AACGCGGCTACAATTAATACATAACC -3′ pOTB7 Sequencing 5′ of inserted DNA
pOTB7_R(358-335) 5′- GTACTGCAGCCGATTCATTAATGC -3′ pOTB7 Sequencing 3′ of inserted DNA
pUAST3′ 5′- AACCAAGTAAATCAACTGC -3′ pUAST Sequencing 5′ of inserted DNA
SV40-3’UTR 5′- ATCTCTGTAGGTAGTTTGTC -3′ pUAST Sequencing 3′ of inserted DNA
ME-720Fw 5′- CCGGATCCGGTGGTGCAAATC -3′ pME18S Sequencing 5′ of inserted DNA
ME-735Fw 5′- GGATGTTGCCTTTACTTCTA -3′ pME18S Sequencing 5′ of inserted DNA
ME-1290Rv 5′- ATAAGCTGCAATAAACAAGTTAACAAC -3′ pME18S Sequencing 3′ of inserted DNA
ME-1250Rv 5′- TGTGGGAGGTTTTTTCTCTA -3′ pME18S Sequencing 3′ of inserted DNA
pGCAP_F 5′- CTCAGTGGATGTTGCCTTTAC -3′ pGCAP1, pGCAP10 Sequencing 5′ of inserted DNA
pGCAP_R 5′- GCATTCTAGTTGTGGTTTGTCC -3′ pGCAP1, pGCAP10 Sequencing 3′ of inserted DNA
pMFG_F 5′- CTTCTCTAGGCGCCCATATG -3′ pMFG Sequencing 5′ of inserted DNA
pMFG_R 5′- GCCTGGACCACTGATATCCT -3′ pMFG Sequencing 3′ of inserted DNA

Related Information

PCR Primers for Detection of Adenovirus Vector
List of STS Markers for Detection of Virus Genes

go to Head

(2011.01.12 T.M.)
