Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Genomic DNA Information


Preparation of Genomic DNA

  1. Suspend bacteria cells in 8 ml of [0.7 M NaCl, 0.1 M EDTA (pH 8.0)] in 50 ml conical tube.
  2. Add 1 ml of 10 mg/ml lysozyme in PBS.
  3. Add 30 ul of 100 mg/ml labiase.
  4. Incubate mixture in 37oC water bath for 1 hour.
  5. Add 1 ml of [0.5 M tris-Cl (pH 7.5), 5% SDS].
  6. Add 25 ul of 10 mg/ml protease K.
  7. Incubate mixture at 60oC for 1 hour.
  8. Extraction of DNA with phenol.
  9. Extraction of DNA with phenol-chloroform.
  10. Extraction of DNA with chloroform-isoamyl alcohol (24:1).
  11. Precipitation of DNA with cold ethanol.
  12. Wash precipitated DNA with 70% ethanol.
  13. Dissolve DNA in 600 ul TE buffer with 1ul of 10 mg/ml RNaseA.
  14. Incubate DNA at 37oC for 30 min.
  15. Add 5 ul of 10 mg/ml protease K.
  16. Incubate DNA at 60oC for 1 hour.
  17. Extraction of DNA with phenol.
  18. Extraction of DNA with phenol-chloroform.
  19. Extraction of DNA with chloroform-isoamyl alcohol (24:1).
  20. Add 100 ul of 3 M sodium acetate (pH5.5).
  21. Add 1.2 ml cold ethanol.
  22. Wash precipitated DNA with 70% ethanol.
  23. Redissolve DNA in 200 ul TE buffer.
  24. Dilute 2 ul of DNA into 400 ul dH2O and analyze OD260.

Reconstitution of DNA

  • In the case you received plastic vials contains vacuum dried DNA.
    • A precipitant might stick to the lid or wall during transportation.
    • Before opening the tube, please spin down a minute or two at 5,000 g (~7,000 rpm, table top microfuge).
    • Add sterilized water as much as “shipping volume” appeared on the data PDF. Caution: Make sure the “LOT NUMBERS MATCH UP” on the tube and the PDF. Dissolve DNA by gently tapping. This will make the DNA solution as the concentration appeared on the data PDF in Tris (10 mM, pH 7.5)-EDTA (1 mM) buffer.
    • If the DNA is difficult to solve, leave the vial at 4 degreeC overnight to allow the DNA to dissolve.
    • Once reconstituted, the DNA should be stored at 4 degreeC for immediate use or -30 degreeC for long term storage.

Related Information

Primers for PCR of rRNA gene

Bacteria 16S rRNA
Name of primer Sequence
EB-20F 5′ AGTTTGATCCTGGCTC 3′
EB-350F 5′ TACGGGAGGCAGCAG 3′
EB-1100R 5′ AGGGTTGCGCTCGTTG 3′
EB-1400R 5′ ACGGGCGGTGTGTAC 3′
EB-1530R 5′ AAGGAGGTGATCCAGCC 3′
Reference of primer

  • Itoh, T., Kudo, T., Oyaizu, H. and Seino, A.
    Two new species in the genus Actinomadura: A. glomerata sp. nov., and A. longicatena sp. nov.
    Actinomycetologica 9: 164-177, 1995.
    DOI: 10.3209/saj.9_164.
  • Namwong, S., Tanasupawat, S., Smitinont, T., Visessanguan, W., Kudo, T. and Itoh, T.
    Isolation of Lentibacillus salicampi strains and Lentibacillus juripiscarius sp. nov. from fish sauce in Thailand.
    Int. J. Syst. Evol. Microbiol. 55: 315-320, 2005.
    PMID: 15653893. DOI: 10.1099/ijs.0.63272-0.
Archaea 16S rRNA
Name of primer Sequence
A-20F 5′ TCCGGTTGATCCTGCCG 3′
A-340F 5′ CCCAGGCCCTACGGG 3′
A-520R 5′ GTATTACCGCGGCGGCTG 3′
A-1100R 5′ CGGGTCTCGCTCGTT 3′
A-1400R 5′ GACGGGCGGTGTGTGC 3′
Reference of primer

  • Itoh, T., Suzuki, K. and Nakase, T.
    Occurrence of introns in the 16S rRNA genes of members of the genus Thermoproteus.
    Arch. Microbiol. 170: 155-161, 1998.
    PMID: 9683654. DOI: 10.1007/s002030050628.
  • Itoh, T., Suzuki, K., Sanchez, P. C. and Nakase, T.
    Caldisphaera lagunensis gen. nov., sp. nov., a novel thermoacidophilic crenarchaeote isolated from a hot spring at Mt Maquiling, Philippines.
    Int. J. Syst. Evol. Microbiol. 53: 1149-1154, 2003.
    PMID: 12892143. DOI: 10.1099/ijs.0.02580-0.
Fungi 26S rRNA
Name of primer Sequence
ITS5 5′ GGAAGTAAAAGTCGTAACAAGG 3′
ITS4 5′ TCCTCCGCTTATTGATATGC 3′
NL1 5′ GCATATCAATAAGCGGAGGAAAAG 3′
NL4 5′ GGTCCGTGTTTCAAGACGG 3′
Reference of primer

  • White, T. J., Bruns, T., Lee, S., and Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315-322, Academic Press, New York.
  • O’Donell, K. (1993). Fusarium and its near relatives, In: Reynolds, D. R. and Taylor, J. W. (eds.), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225-233, CAB International, Wallingford.

Related Website

Related Articles

(T.M. 2012.02.28)

2018.04.13