Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Thermus thermophilus Disruption plasmid


Directed evolution of thermostable kanamycin-resistance gene: a convenient selection marker for Thermus thermophilus.

Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S., Kagamiyama, H.
J. Biochem. 126 (5): 951-956 (1999). PubMed PMID 10544290.

Catalog no. Name of resource Description
RDB03436 pUC18-HTK (with promoter) Expression vector of Thermus highly thermostable kanamycin nucleotidyltransferase (HTK) gene

Depositor: Dr. Jun Hoseki


Thermus thermophilus HB8 Disruption plasmids were constructed by "Whole-Cell Project of a Model Organism, Thermus thermophilus HB8" (http://www.thermus.org/) using the thermostable kanamycin nucleotidyltransferase gene and deposited by Dr. Seiki Kuramitsu.

The gene disruptant of T. thermophils HB8 can be easily prepared by adding this plasmid into the culture medium. The target gene in this plasmid was replaced by the thermostable kanamycin resistant gene from Staphylococcus aureus. The length of the homologous region outside of the target gene is about 500 bp (only 10 bp of the target geneare left in both sides) .

How to obtain Disruption clones


This page

Plasmid clones for disrupting Thermus thermophilus HB8 gene.
Clone(s) is shipped as DNA solution in TE buffer in individual tube.
Please amplify this plasmid clone using E. coli host strain (ex. Stbl2, Invitrogen) suitable for the cloning of unstable inserts such as direct repeats.

Outside database

Please find ID of individual clone(s) using the following outside database
http://www.tanpaku.org/ThermusDB/index.html
or this summary table.

Forms

Please specify ID (ex. TDs01A01) of individual clone(s).

Please indicate Terms and Conditions for Distribution in MTA as follows:

In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, the USER is expected to cite the following literature.
(Yokoyama et al., 2000, Nature Struct. Biol. 7, 943-945).

Please complete forms:

Order Form, FormA
Material Transfer Agreement, FormC
Order Form (FormA) [Open a new window!!]
Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
NOTE: User registration on our system is required before download the Order Form for credit card (Visa / Master).
Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

We ask a signature of the Authorized Representative of a recipient institution.
In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.

(Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format)
Material Transfer Agreement (Category II MTA) [Word]
For the use of our bioresource in research for the following cases:
 1. For research to be conducted by for-profit organizations.
 2. For collaborative research between for-profit organization and not-for-profit organization.
 3, For research by not-for- organization outsourced and sponsored by for-profit organization.
 4. For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Please visit further information of distribution and fees.

Distribution fee per clone:
8,640 YEN (For use in research for not-for-profit academic purpose).
17,280 YEN (For use in research for-profit-research purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Information of Request for Distribution.

Personal data protection policy

For protection of personal data at RIKEN BioResource Research Center, please reffer Personal data protection policy.

Data Sheet

Vector pGEM derivative
thermostable kanamycin resistant gene from Staphylococcus aureus
Sequencing Primer (Vector toward insert) T7long: cgccaagctctaatacgactcactataggg SP6: atttaggtgacactatag
Sequencing Primer (Km toward insert) 7723km F:aatttctggaatggggttca 7723km R:gattgcgatgctgattcgt

Articles Published by Using This Materials

Gene ID (Clone ID) Title Journal Author PMID
TTHA1294 (TDs07A03) Conservation of two distinct types of 100S ribosome in bacteria. Genes Cells, 18 (7): 554-574 (2013). Ueta, M., Wada, C., Daifuku, T., Sako, Y., Bessho, Y., Kitamura, A., Ohniwa, R.L., Morikawa, K., Yoshida, H., Kato, T., Miyata, T., Namba, K., Wada, A. 23663662
TTHB178 (TDs11H02) A novel single-stranded DNA-specific 3′-5′ exonuclease, Thermus thermophilus exonuclease I, is involved in several DNA repair pathways. Nucleic Acids Res., 38 (17), 5692-5705 (2010). Shimada, A., Masui, R., Nakagawa, N., Takahata, Y., Kim, K., Kuramitsu, S., Fukui, K. 20457749
TTHA1619 (TDs08C11) N7-Methylguanine at position 46 (m7G46) in tRNA from Thermus thermophilus is required for cell viability at high temperatures through a tRNA modification network. Nucleic Acids Res., 38, 942-957 (2010). Tomikawa, C., Yokogawa, T., Kanai, T., Hori, H. 19934251

Related article

Molecular mechanisms of the whole DNA repair system: a comparison of bacterial and eukaryotic systems. Shimada, A., Inoue, M., Iino, H., Wakamatsu, T., Fukui, K., Nakagawa, N., Masui, R., Kuramitsu, S. (2010) J. Nucleic Acids 2010: 179594
Increased Rigidity of Domain Structures Enhances the Stability of a Mutant Enzyme Created by Directed Evolution Hoseki, J., Okamoto, A., Takada, N., Suenaga, A., Funatsugi, N., Konagaya, A., Taiji, M., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2003) Biochemistry 42, 14469-14475
Disruption of Thermus thermophilus Genes by Homologous Recombination Using A Thermostable Kanamycin-Resistant Marker Hashimoto, Y., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2001) FEBS Lett. 506, 231-234
Directed Evolution of Thermostable Kanamycin-Resistant Gene Products in an Extremely Thermophilic Bacterium, Thermus thermophilus Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S. and Kagamiyama, H. (1999) J. Biochem. 126, 951-956

Related products

go to Head


(GRP0035e, 2012.10.22 T.M.)

2019.01.14