List of Construct
The Promoter series were validated by restriction enzyme digestion and confirmation of end sequences of insert DNA.
Sequencing Primer
pGL4-4174F: TAGCAAAATAGGCTGTCCCC
pGL4-136R: CTTCGAGTGGGTAGAATGGC
‘Activity’ indicates a value of the fold induction compared with empty vector.
-, less than 2
+, 2 to 5
++, 5 to 10
actual value, more than 10
Locus symbol | Catalog No. | Name of clone | Size of PCR amplified DNA | Activity in | Results (pdf) | ||
---|---|---|---|---|---|---|---|
HeLa | HepG2 | Hep3B | |||||
Control vector | | pGL3 Control | | 372.4 | 159.9 | 226.6 | |
ABCA1 | RDB07680 | pGL4-phABCA1 | cloned fragment: 104929286 to 104928133(NC_000009.12); relatively -1117 to +37, where +1 corresponds to 1 nt of NM_005502.4 | 63.5 | 51 | 11.3 | [pdf] |
ABCB1 | RDB07315 | pGL4-phABCB1 | cloned fragment: 87714385 to 87713167(NC_000007.14); relatively -1062 to +157, where +1 corresponds to 1 nt of NM_001348945.1 | – | – | + | [pdf] |
ADM | RDB07808 | pGL4-phADM | cloned fragment: 10303763 to 10305239(NC_000011.10 ); relatively -1310 to +167, where +1 corresponds to 1 nt of NM_001124.3 | 588.5 | 55.5 | 50.2 | [pdf] |
ADRB2 | RDB07532 | pGL4-phADRB2 | cloned fragment: 148825201 to 148826646(NC_000005.10); relatively -1392 to +54, where +1 corresponds to 1 nt of NM_000024.5 | 161 | 119 | 21.5 | [pdf] |
AGT | RDB07683 | pGL4-phAGT | cloned fragment: 230716077 to 230714584(NC_000001.11); relatively -1955 to -461, where +1 corresponds to 1 nt of NM_000029.4 | – | – | – | [pdf] |
AHR | RDB07724 | pGL4-phAHR | cloned fragment: 17297271 to 17298730(NC_000007.14); relatively -1381 to +79, where +1 corresponds to 1 nt of NM_001621.5 | 225.3 | 67.8 | 49.6 | [pdf] |
AIFM2 | RDB07332 | pGL4-phAIFM2 | cloned fragment: 70134069 to 70132792(NC_000010.11); relatively -1135 to +143, where +1 corresponds to 1 nt of NM_001198696.1 | 105 | 268 | 177 | [pdf] |
AKT1 | RDB07331 | pGL4-phAKT1 | cloned fragment: 104794722 to 104793571(NC_000014.9); relatively -1121 to +31, where +1 corresponds to 1 nt of NM_005163.2 | – | + | + | [pdf] |
ALB | RDB07818 | pGL4-phALB | cloned fragment: 73402814 to 73404284(NC_000004.12); relatively -1473 to -2, where +1 corresponds to 1 nt of NM_000477.7 | + | – | + | [pdf] |
ALDOA | RDB07512 | pGL4-phALDOA | cloned fragment: 30051970 to 30053201(NC_000016.10); relatively -1120 to +112, where +1 corresponds to 1 nt of NM_000034.3 | 15.5 | 80.4 | 13.7 | [pdf] |
ANTXR1 | RDB07333 | pGL4-phANTXR1 | cloned fragment: 69012220 to 69013408(NC_000002.12); relatively -924 to +265, where +1 corresponds to 1 nt of NM_032208.2 | 88.5 | 30 | 36 | [pdf] |
APAF1 | RDB07316 | pGL4-phAPAF1 | cloned fragment: 98644170 to 98645321(NC_000012.12); relatively -1130 to +22, where +1 corresponds to 1 nt of NM_013229.2 | 31 | 101 | 43 | [pdf] |
APCS | RDB07317 | pGL4-phAPCS | cloned fragment: 159586692 to 159587854(NC_000001.11); relatively -1134 to +29, where +1 corresponds to 1 nt of NM_001639.4 | + | + | + | [pdf] |
APEX1 | RDB07729 | pGL4-phAPEX1 | cloned fragment: 20453836 to 20455295(NC_000014.9); relatively -1390 to +70, where +1 corresponds to 1 nt of NM_001641.4 | 216.5 | 99 | 67.8 | [pdf] |
APOA1 | RDB07684 | pGL4-phAPOA1 | cloned fragment: 116839091 to 116837607(NC_000011.10 ); relatively -1141 to +344, where +1 corresponds to 1 nt of NM_000039.2 | ++ | 144 | + | [pdf] |
APOB | RDB07527 | pGL4-phAPOB | cloned fragment: 21045468 to 21044033(NC_000002.12); relatively -1395 to +41, where +1 corresponds to 1 nt of NM_000384.3 | – | 14.5 | + | [pdf] |
APOC3 | RDB07303 | pGL4-phAPOC3 | cloned fragment: 116829078 to 116830062(NC_000011.10); relatively -829 to +156, where +1 corresponds to 1 nt of NM_000040.3 | + | 158 | 33 | [pdf] |
APOE | RDB07556 | pGL4-phAPOE | cloned fragment: 44904368 to 44905816(NC_000019.10); relatively -1428 to +21, where +1 corresponds to 1 nt of NM_001302688.2 | 88.3 | ++ | ++ | [pdf] |
APP | RDB07692 | pGL4-phAPP | cloned fragment: 26172063 to 26170592(NC_000021.9); relatively -1293 to +179, where +1 corresponds to 1 nt of NM_000484.4 | ++ | + | + | [pdf] |
AQP3 | RDB07311 | pGL4-phAQP3 | cloned fragment: 33448723 to 33447505 (NC_000009.12); relatively -1090 to +129, where +1 corresponds to 1nt of NM_004925.4 | 19 | 17 | 93.3 | [pdf] |
AR | RDB07690 | pGL4-phAR | cloned fragment: 67542821 to 67544310(NC_000023.11); relatively -1802 to -312, where +1 corresponds to 1 nt of NM_000044.4 | 19.3 | ++ | ++ | [pdf] |
ARNT | RDB07731 | pGL4-phARNT | cloned fragment: 150878102 to 150876641(NC_000001.11); relatively -1503 to -41, where +1 corresponds to 1 nt of NM_001668.4 and relatively -1392 to +70, where +1 corresponds to 1 nt of XM_005245151.2 | 203 | 214.3 | 191.8 | [pdf] |
ASNS | RDB07305 | pGL4-phASNS | cloned fragment: 97873685 to 97872433(NC_000007.14); relatively -1399 to -146, where +1 corresponds to 1 nt of NM_133436.3 and relatively -1156 to +97, where +1 corresponds to 1 nt of NM_001673.5 | 1104 | 254 | 6536.7 | [pdf] |
ATF2 | RDB07712 | pGL4-phATF2 | cloned fragment: 175169601 to 175168132(NC_000002.12); relatively -1398 to +72, where +1 corresponds to 1 nt of NM_001880.4 | 140 | 82.8 | 67.6 | [pdf] |
ATF3 | RDB07710 | pGL4-phATF3 | cloned fragment: 212607207 to 212608688(NC_000001.11); relatively -1554 to -72, where +1 corresponds to 1 nt of NM_001674.4 | 40 | 54.5 | 43.3 | [pdf] |
ATR | RDB07334 | pGL4-phATR | cloned fragment: 142579948 to 142578802(NC_000003.12); relatively -1215 to -68, where +1 corresponds to 1 nt of NM_001184.4 | 105.5 | 408 | 308 | [pdf] |
B2M | RDB07479 | pGL4-phB2M | cloned fragment: 44710090 to 44711509(NC_000015.10); relatively -1427 to -7, where +1 corresponds to 1 nt of NM_004048.3 and relatively -1402 to +18, where +1 corresponds to 1 nt of XM_005254549.3 | 339.5 | ++ | + | [pdf] |
BAI1 | RDB07401 | pGL4-phBAI1 | cloned fragment: 142462682 to 142464049(NC_000008.11); relatively +12979 to +14347, where +1 corresponds to 1 nt of NM_001702.3 and relatively -1333 to +35, where +1 corresponds to 1 nt of NM_001702.2 | + | + | + | [pdf] |
BAK1 | RDB07318 | pGL4-phBAK1 | cloned fragment: 33581433 to 33580241(NC_000006.12); relatively -1157 to +36, where +1 corresponds to 1 nt of NM_001188.4 | 22 | 91 | 34 | [pdf] |
BCL2 | RDB07567 | pGL4-phBCL2 | cloned fragment: 63320698 to 63319352(NC_000018.10); relatively -1318 to +29, where +1 corresponds to 1 nt of NM_000633.2 | 21 | ++ | ++ | [pdf] |
BCL2L1 | RDB07335 | pGL4-phBCL2L1 | cloned fragment: 31724021 to 31722808(NC_000020.11); relatively -1117 to +97, where +1 corresponds to 1 nt of NM_138578.3 | ++ | 56 | 147 | [pdf] |
BRCA1 | RDB07296 | pGL4-phBRCA1 | cloned fragment: 43,125,397 to 43,126,526 (NC_000017.11); relatively -1.0 kb to +87, where +1 corresponds to 1 nt of NM_007294.3 | 44.5 | 42 | 238 | [pdf] |
BRCA2 | RDB07691 | pGL4-phBRCA2 | cloned fragment: 32,314,131 to 32,315,604 (NC_000013.11); relatively -1.3 kb to +125, where +1 corresponds to 1 nt of NM_000059.3 | 48 | 22 | 49.9 | [pdf] |
BTG2 | RDB07402 | pGL4-phBTG2 | cloned fragment: 203304202 to 203305557(NC_000001.11); relatively -1334 to +22, where +1 corresponds to 1 nt of NM_006763.3 | 285 | 1162 | 271 | [pdf] |
C12orf5 | RDB07414 | pGL4-phC12orf5 | cloned fragment: 4319879 to 4321213(NC_000012.12); relatively -1334 to +1, where +1 corresponds to 1 nt of NM_020375.3 | 63 | 234 | 138 | [pdf] |
CABLES1 | RDB07337 | pGL4-phCABLES1 | cloned fragment: 23154667 to 23155888(NC_000018.10); relatively -1158 to +64, where +1 corresponds to 1 nt of NM_138375.2 | – | – | + | [pdf] |
CALCA | RDB07291 | pGL4-phCALCA | cloned fragment: 14973573 to 14972253(NC_000011.10); relatively -1222 to +99, where +1 corresponds to 1 nt of NM_001741.3 | 271 | 105 | 322 | [pdf] |
CASP1 | RDB07338 | pGL4-phCASP1 | cloned fragment: 105036277 to 105035109(NC_000011.10); relatively -1133 to +36, where +1 corresponds to 1 nt of NM_033292.4 | ++ | 16 | 20 | [pdf] |
CAV1 | RDB07364 | pGL4-phCAV1 | cloned fragment: 116523610 to 116524918(NC_000007.14); relatively -1175 to +134, where +1 corresponds to 1 nt of NM_001753.4 | + | – | + | [pdf] |
CCND1 | RDB07299 | pGL4-phCCND1 | cloned fragment: 69639958 to 69641148(NC_000011.10); relatively -1147 to +44, where +1 corresponds to 1 nt of NM_053056.2 | + | 170 | ++ | [pdf] |
CD44 | RDB07685 | pGL4-phCD44 | cloned fragment: 35137703 to 35139162(NC_000011.10); relatively -1167 to +293, where +1 corresponds to 1 nt of NM_000610.3 | ++ | – | – | [pdf] |
CD55 | RDB07539 | pGL4-phCD55 | cloned fragment: 207320088 to 207321519(NC_000001.11); relatively -1590 to -158, where +1 corresponds to 1 nt of NM_000574.5 | ++ | + | + | [pdf] |
CD82 | RDB07416 | pGL4-phCD82 | cloned fragment: 44564415 to 44565733(NC_000011.10); relatively -1248 to +71, where +1 corresponds to 1 nt of NM_002231.4 | 96.5 | 192 | 30.5 | [pdf] |
CDC2 | RDB07816 | pGL4-phCDC2 | cloned fragment: 60777041 to 60778517(NC_000010.11); relatively -1437 to +40, where +1 corresponds to 1 nt of NM_001786.5 | 186 | 36.8 | 17.1 | [pdf] |
CDC25A | RDB07709 | pGL4-phCDC25A | cloned fragment: 48189750 to 48188291(NC_000003.12); relatively -1333 to +127, where +1 corresponds to 1 nt of NM_001789.3 | 148.3 | 33.5 | 72.4 | [pdf] |
CDK4 | RDB07907 | pGL4-phCDK4 | cloned fragment: 57753838 to 57752340(NC_000012.12); relatively -1528 to -29, where +1 corresponds to 1 nt of NM_000075.4 | 108.5 | 43.3 | 27.5 | [pdf] |
CDKN1A | RDB07302 | pGL4-phCDKN1A | cloned fragment: 36677551 to 36678753(NC_000006.12); relatively -1128 to +75, where +1 corresponds to 1 nt of NM_000389.4 | 29 | 78 | 38 | [pdf] |
CEBPA | RDB07812 | pGL4-phCEBPA | cloned fragment: 33303920 to 33302423(NC_000019.10); relatively -1356 to +142, where +1 corresponds to 1 nt of NM_001285829.1 | 66.5 | 33.5 | 35.1 | [pdf] |
CEBPE | RDB07713 | pGL4-phCEBPE | cloned fragment: 23120684 to 23119221(NC_000014.9); relatively -1073 to +391, where +1 corresponds to 1 nt of NM_001805.3 | + | – | – | [pdf] |
CGA | RDB07456 | pGL4-phCGA | cloned fragment: 87096335 to 87095063(NC_000006.12); relatively -1229 to +44, where +1 corresponds to 1 nt of NM_001252383.2 | 137 | 31 | 573.3 | [pdf] |
CHEK1 | RDB07319 | pGL4-phCHEK1 | cloned fragment: 125625268 to 125626475(NC_000011.10); relatively +132 to +1340, where +1 corresponds to 1 nt of NM_001114122.2 and relatively -1088 to +120, where +1 corresponds to 1 nt of NM_001274.5 | 83.5 | 31 | 110 | [pdf] |
CHEK2 | RDB07407 | pGL4-phCHEK2 | cloned fragment: 28743124 to 28741813(NC_000022.11); relatively -1290 to +22, where +1 corresponds to 1 nt of NM_007194.3 | 57 | 80 | 34 | [pdf] |
CHUK | RDB07383 | pGL4-phCHUK | cloned fragment: 100230864 to 100229550(NC_000010.11); relatively -1268 to +47, where +1 corresponds to 1 nt of NM_001278.5 | 767 | 820 | 944 | [pdf] |
COL1A1 | RDB07459 | pGL4-phCOL1A1 | cloned fragment: 50202872 to 50201613(NC_000017.11); relatively -1233 to +27, where +1 corresponds to 1 nt of NM_000088.3 | 240.5 | ++ | 10.8 | [pdf] |
CREM | RDB07811 | pGL4-phCREM | cloned fragment: 35125718 to 35127179(NC_000010.11); relatively -1509 to -47, where +1 corresponds to 1 nt of NM_181571.3 and relatively -1391 to +71, where +1 corresponds to 1 nt of XM_011519324.2 | 195.5 | 110.5 | 120.8 | [pdf] |
CSF2 | RDB07482 | pGL4-phCSF2 | cloned fragment: 132072406 to 132073823(NC_000005.10); relatively -1383 to +35, where +1 corresponds to 1 nt of NM_000758.4 | ++ | + | – | [pdf] |
CSNK2A1 | RDB07483 | pGL4-phCSNK2A1 | cloned fragment: 545209 to 543808(NC_000020.11); relatively -1419 to -17, where +1 corresponds to 1 nt of NM_177559.3 | 94 | 64 | 78.3 | [pdf] |
CTGF | RDB07807 | pGL4-phCTGF | cloned fragment: 131952827 to 131951335(NC_000006.12); relatively -1455 to +38, where +1 corresponds to 1 nt of NM_001901.3 | 248.5 | 102.5 | 16.6 | [pdf] |
CX3CL1 | RDB07340 | pGL4-phCX3CL1 | cloned fragment: 57371363 to 57372598(NC_000016.10); relatively -1127 to +109, where +1 corresponds to 1 nt of NM_002996.6 | – | – | + | [pdf] |
CXCL12 | RDB07687 | pGL4-phCXCL12 | cloned fragment: 44386542 to 44385073(NC_000010.11); relatively -1445 to +25, where +1 corresponds to 1 nt of NM_199168.4 | 21 | 27.3 | 14.3 | [pdf] |
CYP11A1 | RDB07460 | pGL4-phCYP11A1 | cloned fragment: 74368927 to 74367710(NC_000015.10); relatively -1281 to -63, where +1 corresponds to 1 nt of NM_000781.3 | + | + | – | [pdf] |
CYP1A1 | RDB07541 | pGL4-phCYP1A1 | cloned fragment: 74726956 to 74725495(NC_000015.10); relatively -1428 to +34, where +1 corresponds to 1 nt of NM_000499.5 | 590.7 | 43.8 | 33.5 | [pdf] |
DDC | RDB07555 | pGL4-phDDC | cloned fragment: 50562516 to 50561019(NC_000007.14); relatively +2889 to +4387, where +1 corresponds to 1 nt of NM_001082971.2 and relatively -1445 to +53, where +1 corresponds to 1 nt of NM_000790.4 | 21.3 | + | – | [pdf] |
DKK1 | RDB07341 | pGL4-phDKK1 | cloned fragment: 52313141 to 52314306(NC_000010.11); relatively -1140 to +26, where +1 corresponds to 1 nt of NM_012242.4 | 20.5 | 35 | 44 | [pdf] |
DRAM | RDB07412 | pGL4-phDRAM | cloned fragment: 101876102 to 101877447(NC_000012.12); relatively -1478 to -132, where +1 corresponds to 1 nt of NM_018370.3 and relatively -1340 to +6, where +1 corresponds to 1 nt of XM_005269004.2 | 59.5 | 62 | 15 | [pdf] |
DUSP1 | RDB07368 | pGL4-phDUSP1 | cloned fragment: 172772338 to 172771174(NC_000005.10); relatively -1143 to +22, where +1 corresponds to 1 nt of NM_004417.4 | 173.8 | 176.8 | 1083.5 | [pdf] |
DUSP12 | RDB07384 | pGL4-phDUSP12 | cloned fragment: 161748494 to 161749803(NC_000001.11); relatively -1274 to +36, where +1 corresponds to 1 nt of NM_007240.3 | 1593 | 1221 | 1937 | [pdf] |
E2F1 | RDB07810 | pGL4-phE2F1 | cloned fragment: 33687850 to 33686378(NC_000020.11); relatively -1465 to +8, where +1 corresponds to 1 nt of NM_005225.3 | 63.5 | ++ | 10.6 | [pdf] |
E2F2 | RDB07904 | pGL4-phE2F2 | cloned fragment: 23532436 to 23530968(NC_000001.11); relatively -1203 to +266, where +1 corresponds to 1 nt of NM_004091.4 | 32.5 | + | + | [pdf] |
E2F4 | RDB07714 | pGL4-phE2F4 | cloned fragment: 67190703 to 67192172(NC_000016.10); relatively -1452 to +18, where +1 corresponds to 1 nt of NM_001950.4 | 891 | 289 | 317.1 | [pdf] |
EGFR | RDB07398 | pGL4-phEGFR | cloned fragment: 55017912 to 55019251(NC_000007.14); relatively -1105 to +235, where +1 corresponds to 1 nt of NM_005228.5 | 31 | 26 | 65 | [pdf] |
EGR1 | RDB07369 | pGL4-phEGR1 | cloned fragment: 138464340 to 138465649(NC_000005.10); relatively -1152 to +158, where +1 corresponds to 1 nt of NM_001964.3 | 1594.3 | 605 | 5730 | [pdf] |
ELK1 | RDB07908 | pGL4-phELK1 | cloned fragment: 47652041 to 47650572(NC_000023.11); relatively -1437 to +33, where +1 corresponds to 1 nt of NM_001114123.2 | 58.5 | 31 | 20.9 | [pdf] |
EPCAM | RDB07367 | pGL4-phEPCAM | cloned fragment: 47368067 to 47369577(NC_000002.12); relatively -1081 to +430, where +1 corresponds to 1 nt of NM_002354.2 | – | – | 28.5 | [pdf] |
EPHA2 | RDB07342 | pGL4-phEPHA2 | cloned fragment: 16157210 to 16156048(NC_000001.11); relatively -1101 to +62, where +1 corresponds to 1 nt of NM_004431.4 | 26 | 152 | 81 | [pdf] |
ESR1 | RDB07528 | pGL4-phESR1 | cloned fragment: 151806130 to 151807567(NC_000006.12); relatively -1549 to -111, where +1 corresponds to 1 nt of NM_000125.3 and relatively -1189 to +249, where +1 corresponds to 1 nt of NM_001122740.1 | ++ | + | – | [pdf] |
ETS1 | RDB07819 | pGL4-phETS1 | cloned fragment: 128523650 to 128522176(NC_000011.10 ); relatively -1340 to +135, where +1 corresponds to 1 nt of NM_005238.4 | 82 | 36.3 | 16.1 | [pdf] |
EZH2 | RDB07370 | pGL4-phEZH2 | cloned fragment: 148885505 to 148884301(NC_000007.14); relatively -1156 to +49, where +1 corresponds to 1 nt of NM_004456.4 | ++ | ++ | 65.5 | [pdf] |
F3 | RDB07458 | pGL4-phF3 | cloned fragment: 94542880 to 94541623(NC_000001.11); relatively -1023 to +235, where +1 corresponds to 1 nt of NM_001993.4 | 40 | 13 | 10 | [pdf] |
F8 | RDB07519 | pGL4-phF8 | cloned fragment: 155024069 to 155022695(NC_000023.11); relatively -1346 to +29, where +1 corresponds to 1 nt of NM_000132.3 | + | – | – | [pdf] |
FAS | RDB07349 | pGL4-phFAS | cloned fragment: 88989317 to 88990647(NC_000010.11); relatively -1481 to -150, where +1 corresponds to 1 nt of NM_000043.6 and relatively -1242 to +89, where +1 corresponds to 1 nt of NR_028033.3 | – | + | ++ | [pdf] |
FDXR | RDB07385 | pGL4-phFDXR | cloned fragment: 74874305 to 74872957(NC_000017.11); relatively -1274 to +75, where +1 corresponds to 1 nt of NM_024417.4 | 756 | 2295 | 921 | [pdf] |
FLT1 | RDB07726 | pGL4-phFLT1 | cloned fragment: 28496434 to 28494969(NC_000013.11); relatively -1306 to +160, where +1 corresponds to 1 nt of NM_002019.4 | 82 | 10.5 | ++ | [pdf] |
FOS | RDB07292 | pGL4-phFOS | cloned fragment: 75277609 to 75278869(NC_000014.9); relatively -1169 to +92, where +1 corresponds to 1 nt of NM_005252.4 | 213 | 180 | 150 | [pdf] |
FOSL1 | RDB07476 | pGL4-phFOSL1 | cloned fragment: 65901742 to 65900422(NC_000011.10); relatively -1354 to -33, where +1 corresponds to 1 nt of NM_005438.5 and relatively -1216 to +105, where +1 corresponds to 1 nt of NR_125339.1 | 12.5 | ++ | ++ | [pdf] |
GADD45A | RDB07320 | pGL4-phGADD45A | cloned fragment: 67684030 to 67685254(NC_000001.11); relatively -1171 to +54, where +1 corresponds to 1 nt of NM_001924.4 | 214.5 | 675 | 313 | [pdf] |
GADD45B | RDB07529 | pGL4-phGADD45B | cloned fragment: 2474664 to 2476169(NC_000019.10); relatively -1463 to +43, where +1 corresponds to 1 nt of NM_015675.4 | 2122.7 | 268.5 | 132.5 | [pdf] |
GH2 | RDB07309 | pGL4-phGH2 | cloned fragment: 63919971 to 63881830(NC_000017.11); relatively -38027 to +115, where +1 corresponds to 1 nt of NM_002059.5 | 92 | 12 | 90 | [pdf] |
GJA1 | RDB07538 | pGL4-phGJA1 | cloned fragment: 121434391 to 121435646(NC_000006.12); relatively -1186 to +70, where +1 corresponds to 1 nt of NM_000165.5 | 16.4 | ++ | ++ | [pdf] |
GLI1 | RDB07902 | pGL4-phGLI1 | cloned fragment: 57458742 to 57460211(NC_000012.12); relatively -1043 to +427, where +1 corresponds to 1 nt of NM_005269.3 and relatively -1396 to +74, where +1 corresponds to 1 nt of XM_011538190.2 | + | + | + | [pdf] |
GML | RDB07371 | pGL4-phGML | cloned fragment: 142833526 to 142834833(NC_000008.11); relatively -1275 to +33, where +1 corresponds to 1 nt of NM_002066.3 | – | + | ++ | [pdf] |
GSTP1 | RDB07477 | pGL4-phGSTP1 | cloned fragment: 67582608 to 67583850(NC_000011.10); relatively -987 to +256, where +1 corresponds to 1 nt of NM_000852.3 | 93 | 294.4 | 99.2 | [pdf] |
HDAC1 | RDB07484 | pGL4-phHDAC1 | cloned fragment: 32290713 to 32292183(NC_000001.11); relatively -1370 to +101, where +1 corresponds to 1 nt of NM_004964.3 | 42 | 156 | 141.3 | [pdf] |
HIF1A | RDB07693 | pGL4-phHIF1A | cloned fragment: 61694082 to 61695550(NC_000014.9); relatively -1431 to +38, where +1 corresponds to 1 nt of NM_001530.4 | 15.3 | 25.3 | 33 | [pdf] |
HIST2H2AB | RDB07909 | pGL4-phHIST2H2AB | cloned fragment: 119096856 to 119095396(NC_000011.10 ); relatively -1389 to +72, where +1 corresponds to 1 nt of NM_002105.2 | 2425 | 100.8 | 102.3 | [pdf] |
HLA-DQB1 | RDB07557 | pGL4-phHLA-DQB1 | cloned fragment: 32668102 to 32666641(NC_000006.12); relatively -1445 to +17, where +1 corresponds to 1 nt of NM_002123.5 | 30.7 | 10.5 | ++ | [pdf] |
HLA-DRA | RDB07389 | pGL4-phHLA-DRA | cloned fragment: 32438507 to 32439912(NC_000006.12); relatively -1380 to +26, where +1 corresponds to 1 nt of NM_019111.5 | 44 | + | ++ | [pdf] |
HLA-E | RDB07388 | pGL4-phHLA-E | cloned fragment: 30488374 to 30489534(NC_000006.12); relatively -1135 to +26, where +1 corresponds to 1 nt of NM_005516.6 | 134 | 75 | 453.3 | [pdf] |
HMOX1 | RDB07485 | pGL4-phHMOX1 | cloned fragment: 35,379,656 to 35,381,125 (NC_000022.11); relatively -1,440 to +30, where +1 corresponds to 1 nt of NM_002133.3 | 45.5 | ++ | ++ | [pdf] |
HNF4A | RDB07534 | pGL4-phHNF4A | cloned fragment: 44399893 to 44401377(NC_000020.11); relatively -1363 to +122, where +1 corresponds to 1 nt of NM_178849.2 | + | + | – | [pdf] |
HPGD | RDB07457 | pGL4-phHPGD | cloned fragment: 174523666 to 174522440(NC_000004.12); relatively -1178 to +49, where +1 corresponds to 1 nt of NM_000860.6 | + | + | 13.3 | [pdf] |
HSP90AB1 | RDB07321 | pGL4-phHSP90AB1 | cloned fragment: 44245932 to 44247147(NC_000006.12); relatively -1026 to +190, where +1 corresponds to 1 nt of NM_001271969.1 | 503.5 | 560 | 596 | [pdf] |
HSPB1 | RDB07530 | pGL4-phHSPB1 | cloned fragment: 76301177 to 76302661(NC_000007.14); relatively -1496 to -11, where +1 corresponds to 1 nt of NM_001540.5 | 27 | 56.3 | ++ | [pdf] |
ICAM1 | RDB07390 | pGL4-phICAM1 | cloned fragment: 10269837 to 10271163(NC_000019.10); relatively -1283 to +44, where +1 corresponds to 1 nt of NM_000201.3 | 17.5 | ++ | + | [pdf] |
ID2 | RDB07306 | pGL4-phID2 | cloned fragment: 8680707 to 8682179(NC_000002.12); relatively -1349 to +124, where +1 corresponds to 1 nt of NM_002166.5 | 1140 | 316 | 2603.3 | [pdf] |
IFI16 | RDB07372 | pGL4-phIFI16 | cloned fragment: 159008613 to 159009928(NC_000001.11); relatively -1279 to +37, where +1 corresponds to 1 nt of NM_001206567.1 | ++ | ++ | 61.5 | [pdf] |
IFNG | RDB07297 | pGL4-phIFNG | cloned fragment: 68160883 to 68159668(NC_000012.12); relatively -1142 to +74, where +1 corresponds to 1 nt of NM_000619.3 | 12 | + | 21 | [pdf] |
IFNGR1 | RDB07708 | pGL4-phIFNGR1 | cloned fragment: 137220865 to 137219400(NC_000006.12); relatively -1435 to +31, where +1 corresponds to 1 nt of NM_000416.2 | 213 | 167.5 | 176.9 | [pdf] |
IGF2 | RDB07727 | pGL4-phIGF2 | cloned fragment: 2140216 to 2138757(NC_000011.10); relatively -827 to +633, where +1 corresponds to 1 nt of NM_000612.6 and relatively -1242 to +218, where +1 corresponds to 1 nt of NM_000612.5 | 18 | ++ | + | [pdf] |
IGFBP3 | RDB07568 | pGL4-phIGFBP3 | cloned fragment: 45922417 to 45921216(NC_000007.14); relatively -1145 to +57, where +1 corresponds to 1 nt of NM_001013398.2 | 119 | 49.5 | 22.2 | [pdf] |
IL1A | RDB07682 | pGL4-phIL1A | cloned fragment: 112786862 to 112785369(NC_000002.12); relatively -1464 to +30, where +1 corresponds to 1 nt of NM_000575.4 | – | – | – | [pdf] |
IL2 | RDB07391 | pGL4-phIL2 | cloned fragment: 122457684 to 122456439(NC_000004.12); relatively -1189 to +57, where +1 corresponds to 1 nt of NM_000586.3 | – | – | – | [pdf] |
IL2RA | RDB07525 | pGL4-phIL2RA | cloned fragment: 6063761 to 6062289(NC_000010.11); relatively -1391 to +82, where +1 corresponds to 1 nt of NM_000417.2 | – | – | – | [pdf] |
IL5 | RDB07392 | pGL4-phIL5 | cloned fragment: 132544758 to 132543482(NC_000005.10); relatively -1236 to +41, where +1 corresponds to 1 nt of NM_000879.3 | – | – | – | [pdf] |
IL6 | RDB07313 | pGL4-phIL6 | cloned fragment: 22725956 to 22727254(NC_000007.14); relatively -1186 to +113, where +1 corresponds to 1 nt of NM_000600.4 | 94.5 | – | ++ | [pdf] |
IL8 | RDB07322 | pGL4-phIL8 | cloned fragment: 73739341 to 73740603(NC_000004.12); relatively -1165 to +98, where +1 corresponds to 1 nt of NM_000584.3 | 376.5 | 1675 | 568 | [pdf] |
INS | RDB07387 | pGL4-phINS | cloned fragment: 2162444 to 2161182(NC_000011.10); relatively -1235 to +28, where +1 corresponds to 1 nt of NM_000207.3 | + | + | ++ | [pdf] |
IRF3 | RDB07821 | pGL4-phIRF3 | cloned fragment: 49667274 to 49665802(NC_000019.10); relatively -1417 to +56, where +1 corresponds to 1 nt of NM_001571.6 | 37 | 37 | 27.8 | [pdf] |
JUN | RDB07298 | pGL4-phJUN | cloned fragment: 58785253 to 58784090(NC_000001.11); relatively -1206 to -42, where +1 corresponds to 1 nt of NM_002228.4 | 329.5 | 2332 | 770 | [pdf] |
KLK3 | RDB07324 | pGL4-phKLK3 | cloned fragment: 50853756 to 50854937(NC_000019.10); relatively -1159 to +23, where +1 corresponds to 1 nt of NM_001648.2 | + | ++ | ++ | [pdf] |
KLKB1 | RDB07373 | pGL4-phKLKB1 | cloned fragment: 186226277 to 186227580(NC_000004.12); relatively -1194 to +110, where +1 corresponds to 1 nt of NM_000892.4 | ++ | ++ | ++ | [pdf] |
LEF1 | RDB07553 | pGL4-phLEF1 | cloned fragment: 108169899 to 108168395(NC_000004.12); relatively -967 to +538, where +1 corresponds to 1 nt of NM_016269.5 relatively -1477 to +28, where +1 corresponds to 1 nt of NM_016269.3 | ++ | + | – | [pdf] |
LEP | RDB07688 | pGL4-phLEP | cloned fragment: 128239886 to 128241342(NC_000007.14 ); relatively -1392 to +65, where +1 corresponds to 1 nt of NM_000230.3 | ++ | + | + | [pdf] |
LIF | RDB07417 | pGL4-phLIF | cloned fragment: 30248070 to 30246767(NC_000022.11); relatively -1219 to +85, where +1 corresponds to 1 nt of NM_002309.4 | ++ | + | + | [pdf] |
LTA | RDB07486 | pGL4-phLTA | cloned fragment: 31570952 to 31572360(NC_000006.12 ); relatively -1147 to +262, where +1 corresponds to 1 nt of NM_001159740.2 | – | – | – | [pdf] |
MAD1L1 | RDB07374 | pGL4-phMAD1L1 | cloned fragment: 2234298 to 2232920(NC_000007.14); relatively -1353 to +26, where +1 corresponds to 1 nt of NM_003550.3 | 472 | 450 | 901 | [pdf] |
MAT2A | RDB07393 | pGL4-phMAT2A | cloned fragment: 85537937 to 85539213(NC_000002.12); relatively -1231 to +46, where +1 corresponds to 1 nt of NM_005911.6 | 237.5 | 247 | 381.5 | [pdf] |
MDM2 | RDB07403 | pGL4-phMDM2 | cloned fragment: 68806988 to 68808306(NC_000012.12); relatively -1184 to +135, where +1 corresponds to 1 nt of NM_002392.5 | ++ | 48 | 30 | [pdf] |
MDM4 | RDB07418 | pGL4-phMDM4 | cloned fragment: 204515095 to 204516413(NC_000001.11); relatively -1311 to +8, where +1 corresponds to 1 nt of NM_002393.5 | 669 | 885 | 475 | [pdf] |
MET | RDB07554 | pGL4-phMET | cloned fragment: 116670988 to 116672444(NC_000007.14); relatively -1208 to +249, where +1 corresponds to 1 nt of NM_001127500.3 | + | + | + | [pdf] |
MGP | RDB07394 | pGL4-phMGP | cloned fragment: 14887086 to 14885795(NC_000012.12); relatively -1024 to +268, where +1 corresponds to 1 nt of NM_001190839.2 | ++ | – | – | [pdf] |
MIF | RDB07913 | pGL4-phMIF | cloned fragment: 23892945 to 23894404(NC_000022.11); relatively -1438 to +22, where +1 corresponds to 1 nt of NM_002415.2 | 40 | 34 | 50.8 | [pdf] |
MKI67 | RDB07323 | pGL4-phMKI67 | cloned fragment: 128127561 to 128126143(NC_000010.11); relatively -1357 to +62, where +1 corresponds to 1 nt of NM_002417.4 | 60.5 | 153 | 46 | [pdf] |
MMP2 | RDB07314 | pGL4-phMMP2 | cloned fragment: 55470229 to 55479221(NC_000016.10); relatively -8969 to +24, where +1 corresponds to 1 nt of NM_004530.6 | + | ++ | ++ | [pdf] |
MMP3 | RDB07535 | pGL4-phMMP3 | cloned fragment: 102844952 to 102843589(NC_000011.10); relatively -1343 to +21, where +1 corresponds to 1 nt of NM_002422.5 | + | 18.1 | – | [pdf] |
MMP7 | RDB07536 | pGL4-phMMP7 | cloned fragment: 102532084 to 102530699(NC_000011.10); relatively -1337 to +49, where +1 corresponds to 1 nt of NM_002423.5 | + | – | – | [pdf] |
MMP9 | RDB07537 | pGL4-phMMP9 | cloned fragment: 46007674 to 46009018(NC_000020.11); relatively -1234 to +111, where +1 corresponds to 1 nt of NM_004994.3 | ++ | – | – | [pdf] |
MT1A | RDB07513 | pGL4-phMT1A | cloned fragment: 56634288 to 56638692(NC_000016.10); relatively -4378 to +27, where +1 corresponds to 1 nt of NM_005946.3 | 61.8 | 59.1 | 25.2 | [pdf] |
MYB | RDB07480 | pGL4-phMYB | cloned fragment: 135179905 to 135181339(NC_000006.12 ); relatively -1410 to +25, where +1 corresponds to 1 nt of NM_001130173.1 | ++ | + | 24.2 | [pdf] |
MYC | RDB07325 | pGL4-phMYC | cloned fragment: 127734926 to 127736192(NC_000008.11); relatively -1305 to -38, where +1 corresponds to 1 nt of NM_002467.6 | ++ | ++ | 10 | [pdf] |
MYCN | RDB07820 | pGL4-phMYCN | cloned fragment: 15939093 to 15940561(NC_000002.12); relatively -1457 to +12, where +1 corresponds to 1 nt of NM_001293228.2 | 30 | + | ++ | [pdf] |
NFATC4 | RDB07376 | pGL4-phNFATC4 | cloned fragment: 24366849 to 24368163(NC_000014.9); relatively -62 to +1253, where +1 corresponds to 1 nt of NM_001136022.2 and relatively -1335 to -20, where +1 corresponds to 1 nt of NM_004554.5 | 33 | 19 | 47 | [pdf] |
NFIC | RDB07399 | pGL4-phNFIC | cloned fragment: 3365447 to 3366598(NC_000019.10); relatively -1136 to +16, where +1 corresponds to 1 nt of NM_001245002.2 | 53 | 26 | 59 | [pdf] |
NFKB2 | RDB07478 | pGL4-phNFKB2 | cloned fragment: 102394401 to 102395722(NC_000010.11); relatively -177 to +1145, where +1 corresponds to 1 nt of NM_001077494.3 and relatively -941 to +381, where +1 corresponds to 1 nt of XM_017016278.1 | 718.8 | 83.5 | 44.5 | [pdf] |
NLRC4 | RDB07406 | pGL4-phNLRC4 | cloned fragment: 32266994 to 32265677(NC_000002.12); relatively -1251 to +67, where +1 corresponds to 1 nt of NM_021209.4 | – | + | + | [pdf] |
NME1 | RDB07326 | pGL4-phNME1 | cloned fragment: 51152418 to 51153660(NC_000017.11); relatively -1141 to +102, where +1 corresponds to 1 nt of NM_001018136.3 | 606.5 | 622 | 709 | [pdf] |
NOS2 | RDB07377 | pGL4-phNOS2 | cloned fragment: 27801702 to 27800399(NC_000017.11); relatively -1173 to +131, where +1 corresponds to 1 nt of NM_000625.4 | 21 | ++ | 13 | [pdf] |
NQO1 | RDB07570 | pGL4-phNQO1 | cloned fragment: 69727985 to 69726587(NC_000016.10); relatively -1355 to +44, where +1 corresponds to 1 nt of NM_000903.2 | 998.5 | 209.2 | 98.2 | [pdf] |
NR3C1 | RDB07689 | pGL4-phNR3C1 | cloned fragment: 143404999 to 143403508(NC_000005.10); relatively -1313 to +179, where +1 corresponds to 1 nt of NM_001204258.2 | 13.7 | + | ++ | [pdf] |
NTS | RDB07308 | pGL4-phNTS | cloned fragment: 85873118 to 85874330(NC_000012.12); relatively -1177 to +36, where +1 corresponds to 1 nt of NM_006183.5 | 138 | 38 | 303.3 | [pdf] |
PARP1 | RDB07725 | pGL4-phPARP1 | cloned fragment: 226409429 to 226407965(NC_000001.11); relatively -1336 to +129, where +1 corresponds to 1 nt of NM_001618.4 | 67.5 | 56.5 | 79.6 | [pdf] |
PAX1 | RDB07910 | pGL4-phPAX1 | cloned fragment: 21704218 to 21705707(NC_000020.11); relatively -1446 to +44, where +1 corresponds to 1 nt of NM_006192.5 | 24 | + | + | [pdf] |
PAX6 | RDB07911 | pGL4-phPAX6 | cloned fragment: 31812790 to 31811331(NC_000011.10 ); relatively -1437 to +23, where +1 corresponds to 1 nt of NM_000280.4 | ++ | + | – | [pdf] |
PAX8 | RDB07906 | pGL4-phPAX8 | cloned fragment: 113280371 to 113278890(NC_000002.12); relatively -1450 to +32, where +1 corresponds to 1 nt of NM_003466.4 | ++ | + | – | [pdf] |
PCNA | RDB07365 | pGL4-phPCNA | cloned fragment: 5127783 to 5126581(NC_000020.11); relatively -1161 to +42, where +1 corresponds to 1 nt of NM_002592.2 | 50 | 46.8 | 214 | [pdf] |
PDHA1 | RDB07514 | pGL4-phPDHA1 | cloned fragment: 19342523 to 19343977(NC_000023.11); relatively -1404 to +51, where +1 corresponds to 1 nt of NM_000284.4 | 262.3 | 274.9 | 140.1 | [pdf] |
PENK | RDB07293 | pGL4-phPENK | cloned fragment: 56447221 to 56445951(NC_000008.11); relatively -580 to +691, where +1 corresponds to 1 nt of NM_001135690.3 | 11 | ++ | 40 | [pdf] |
PERP | RDB07411 | pGL4-phPERP | cloned fragment: 138108796 to 138107329(NC_000006.12); relatively -1377 to +91, where +1 corresponds to 1 nt of NM_022121.5 | ++ | 12 | ++ | [pdf] |
PGR | RDB07809 | pGL4-phPGR | cloned fragment: 101131251 to 101129781(NC_000011.10); relatively -1438 to +33, where +1 corresponds to 1 nt of NM_000926.4 | 26 | + | ++ | [pdf] |
PLAT | RDB07295 | pGL4-phPLAT | cloned fragment: 42208678 to 42207652(NC_000008.11); relatively -1113 to -86, where +1 corresponds to 1 nt of NM_000930.5 | + | + | + | [pdf] |
PLAU | RDB07487 | pGL4-phPLAU | cloned fragment: 73909783 to 73911185(NC_000010.11); relatively -1318 to +85, where +1 corresponds to 1 nt of NM_002658.4 | + | 20.5 | + | [pdf] |
PLAUR | RDB07312 | pGL4-phPLAUR | cloned fragment: 43671502 to 43670283(NC_000019.10); relatively -1157 to +63, where +1 corresponds to 1 nt of NM_002659.4 | – | + | + | [pdf] |
PLK1 | RDB07327 | pGL4-phPLK1 | cloned fragment: 23677730 to 23678950(NC_000016.10); relatively -1042 to +179, where +1 corresponds to 1 nt of NM_005030.6 | 11 | 24 | 15 | [pdf] |
PML | RDB07343 | pGL4-phPML | cloned fragment: 73993428 to 73994732(NC_000015.10); relatively -1245 to +60, where +1 corresponds to 1 nt of NM_033238.2 | 15.5 | 115 | 174 | [pdf] |
POLD1 | RDB07344 | pGL4-phPOLD1 | cloned fragment: 50,383,082 – 50,384,389(NC_000019.10); relatively -1.2 kb to +67, where +1 corresponds to 1 nt of NM_001256849.1 | 200 | 145 | 238 | [pdf] |
POU5F1 | RDB07912 | pGL4-phPOU5F1 | cloned fragment: 31172142 to 31170650(NC_000006.12); relatively -1460 to +33, where +1 corresponds to 1 nt of NM_002701.6 | 28.5 | + | + | [pdf] |
PPP1R15A | RDB07307 | pGL4-phPPP1R15A | cloned fragment: 48871193 to 48872414(NC_000019.10); relatively -1199 to +23, where +1 corresponds to 1 nt of NM_014330.3 | 1042 | 626 | 6010 | [pdf] |
PPP2R4 | RDB07294 | pGL4-phPPP2R4 | cloned fragment: 129109782 to 129110998(NC_000009.12); relatively -1532 to -315, where +1 corresponds to 1 nt of NM_178001.2 and relatively -1168 to +49, where +1 corresponds to 1 nt of XM_011518834.2 | 498 | 123 | 870 | [pdf] |
PRKAB1 | RDB07328 | pGL4-phPRKAB1 | cloned fragment: 119666822 to 119667994(NC_000012.12); relatively -1311 to -138, where +1 corresponds to 1 nt of NM_006253.5 | 559.5 | 1031 | 702 | [pdf] |
PSAP | RDB07515 | pGL4-phPSAP | cloned fragment: 71852680 to 71851263(NC_000010.11); relatively -1429 to -11, where +1 corresponds to 1 nt of NM_002778.4 | 219.6 | 268.4 | 133.1 | [pdf] |
PTEN | RDB07400 | pGL4-phPTEN | cloned fragment: 87862065 to 87863506(NC_000010.11); relatively -1560 to -118, where +1 corresponds to 1 nt of NM_000314.7 | + | 75 | ++ | [pdf] |
PTGS2 | RDB07300 | pGL4-phPTGS2 | cloned fragment: 186681620 to 186680368(NC_000001.11); relatively -1197 to +56, where +1 corresponds to 1 nt of NM_000963.4 | 51.5 | 11 | 88 | [pdf] |
PTTG1 | RDB07329 | pGL4-phPTTG1 | cloned fragment: 160420669 to 160421890(NC_000005.10); relatively -1193 to +29, where +1 corresponds to 1 nt of NM_001282382.1 | 43.5 | 14 | 29 | [pdf] |
RAD51 | RDB07813 | pGL4-phRAD51 | cloned fragment: 40693865 to 40695330(NC_000015.10 ); relatively -1309 to +157, where +1 corresponds to 1 nt of NM_002875.5 | 41.5 | 12.3 | 12.8 | [pdf] |
RARB | RDB07905 | pGL4-phRARB | cloned fragment: 25426903 to 25428365(NC_000003.12); relatively -1360 to +103, where +1 corresponds to 1 nt of NM_000965.4 | ++ | 27.3 | 13.4 | [pdf] |
RARG | RDB07903 | pGL4-phRARG | cloned fragment: 53233642 to 53232176(NC_000012.12); relatively -1433 to +34, where +1 corresponds to 1 nt of NM_000966.6 | 14 | + | + | [pdf] |
RB1 | RDB07345 | pGL4-phRB1 | cloned fragment: 48302465 to 48303797(NC_000013.11); relatively -1282 to +51, where +1 corresponds to 1 nt of NM_000321.2 | 175 | 375 | 526 | [pdf] |
REL | RDB07481 | pGL4-phREL | cloned fragment: 60880227 to 60881664(NC_000002.12); relatively -1347 to +91, where +1 corresponds to 1 nt of NM_002908.4 | 39 | 30 | 24.8 | [pdf] |
RELA | RDB07366 | pGL4-phRELA | cloned fragment: 65664031 to 65662883(NC_000011.10); relatively -1059 to +90, where +1 corresponds to 1 nt of NM_021975.3 | 136.8 | 73 | 399 | [pdf] |
RHOA | RDB07404 | pGL4-phRHOA | cloned fragment: 49413224 to 49411909(NC_000003.12); relatively -1127 to +189, where +1 corresponds to 1 nt of NM_001664.4 | 258 | 296 | 422 | [pdf] |
RPRM | RDB07409 | pGL4-phRPRM | cloned fragment: 153479948 to 153478648(NC_000002.12); relatively -1186 to +115, where +1 corresponds to 1 nt of NM_019845.3 | 13.5 | 31 | 25 | [pdf] |
RRM2B | RDB07346 | pGL4-phRRM2B | cloned fragment: 102240355 to 102239033(NC_000008.11); relatively -1237 to +86, where +1 corresponds to 1 nt of NM_015713.4 | ++ | 24.3 | 72.5 | [pdf] |
SCO2 | RDB07415 | pGL4-phSCO2 | cloned fragment: 50526812 to 50525498(NC_000022.11); relatively -1207 to +108, where +1 corresponds to 1 nt of NM_005138.2 | 333.5 | 660 | 124.5 | [pdf] |
SERPINE1 | RDB07461 | pGL4-phSERPINE1 | cloned fragment: 101125677 to 101127125(NC_000007.14); relatively -1412 to +37, where +1 corresponds to 1 nt of NM_000602.4 | 234.5 | 127 | 33.5 | [pdf] |
SESN2 | RDB07413 | pGL4-phSESN2 | cloned fragment: 28258366 to 28259686(NC_000001.11); relatively -1152 to +169, where +1 corresponds to 1 nt of NM_031459.5 | 759.5 | 64 | 519 | [pdf] |
SFN | RDB07408 | pGL4-phSFN | cloned fragment: 26861812 to 26863163(NC_000001.11); relatively -1337 to +15, where +1 corresponds to 1 nt of NM_006142.5 | 49 | 105 | 158 | [pdf] |
SLC2A1 | RDB07814 | pGL4-phSLC2A1 | cloned fragment: 42,960,401 to 42,959,101(NC_000001.11); relatively -1.2 kb to +76, where +1 corresponds to 1 nt of NM_006516.2 | – | + | + | [pdf] |
SMAD1 | RDB07732 | pGL4-phSMAD1 | cloned fragment: 145480402 to 145481868(NC_000004.12); relatively -1451 to +16, where +1 corresponds to 1 nt of NM_005900.3 | 14.5 | ++ | ++ | [pdf] |
SMAD4 | RDB07733 | pGL4-phSMAD4 | cloned fragment: 51028864 to 51030359(NC_000018.10); relatively -1349 to +147, where +1 corresponds to 1 nt of NM_005359.5 | 222 | 126.8 | 94.5 | [pdf] |
SOD1 | RDB07686 | pGL4-phSOD1 | cloned fragment: 31658211 to 31659681(NC_000021.9); relatively -1411 to +60, where +1 corresponds to 1 nt of NM_000454.4 | 288.7 | 32 | 28.1 | [pdf] |
SP1 | RDB07531 | pGL4-phSP1 | cloned fragment: 53378733 to 53380219(NC_000012.12); relatively -1443 to +44, where +1 corresponds to 1 nt of NM_138473.3 | 249.7 | 122 | 130.3 | [pdf] |
SP3 | RDB07817 | pGL4-phSP3 | cloned fragment: 173966777 to 173965316(NC_000002.12); relatively -1075 to +387, where +1 corresponds to 1 nt of NM_003111.4 | 306.5 | 170.5 | 140.9 | [pdf] |
SPP1 | RDB07552 | pGL4-phSPP1 | cloned fragment: 87974284 to 87975705(NC_000004.12); relatively -1366 to +56, where +1 corresponds to 1 nt of NM_001040058.1 | + | + | + | [pdf] |
SSTR2 | RDB07378 | pGL4-phSSTR2 | cloned fragment: 73163842 to 73165161(NC_000017.11); relatively -1168 to +152, where +1 corresponds to 1 nt of NM_001050.3 | 48 | 57 | 116 | [pdf] |
STAT1 | RDB07405 | pGL4-phSTAT1 | cloned fragment: 191015482 to 191014170(NC_000002.12); relatively -1232 to +81, where +1 corresponds to 1 nt of NM_007315.3 | 46.5 | 198 | 103 | [pdf] |
STAT4 | RDB07711 | pGL4-phSTAT4 | cloned fragment: 191152547 to 191151082(NC_000002.12 ); relatively -1553 to -87, where +1 corresponds to 1 nt of NM_003151.4 | + | – | – | [pdf] |
TBXAS1 | RDB07347 | pGL4-phTBXAS1 | cloned fragment: 139828033 to 139829353(NC_000007.14); relatively -1120 to +201, where +1 corresponds to 1 nt of NM_001061.4 | ++ | 46.3 | 25.5 | [pdf] |
TERT | RDB07379 | pGL4-phTERT | cloned fragment: 1296353 to 1295013(NC_000005.10); relatively -1306 to +35, where +1 corresponds to 1 nt of NM_198253.2 | 76 | 27 | 90 | [pdf] |
TF | RDB07540 | pGL4-phTF | cloned fragment: 133744949 to 133746426(NC_000003.12); relatively -1184 to +294, where +1 corresponds to 1 nt of NM_001063.3 | ++ | 35.8 | ++ | [pdf] |
TFF1 | RDB07511 | pGL4-phTFF1 | cloned fragment: 42367873 to 42366498(NC_000021.9); relatively -1338 to +38, where +1 corresponds to 1 nt of NM_003225.3 | 13.2 | 85 | 13.7 | [pdf] |
TG | RDB07304 | pGL4-phTG | cloned fragment: 132865820 to 132866983(NC_000008.11); relatively -1138 to +26, where +1 corresponds to 1 nt of NM_003235.5 | ++ | + | 30 | [pdf] |
TGFA | RDB07348 | pGL4-phTGFA | cloned fragment: 70555154 to 70553850(NC_000002.12); relatively -1139 to +166, where +1 corresponds to 1 nt of NM_003236.3 | 23.3 | 36 | 124 | [pdf] |
TH | RDB07301 | pGL4-phTH | cloned fragment: 2172941 to 2171785(NC_000011.10); relatively -1126 to +31, where +1 corresponds to 1 nt of NM_000360.4 | 68 | 14 | 66.7 | [pdf] |
THBS1 | RDB07728 | pGL4-phTHBS1 | cloned fragment: 39579674 to 39581147(NC_000015.10); relatively -1405 to +69, where +1 corresponds to 1 nt of NM_003246.4 | 171.5 | 33.5 | 12.3 | [pdf] |
TIMP1 | RDB07516 | pGL4-phTIMP1 | cloned fragment: 47581006 to 47582331(NC_000023.11); relatively -1430 to -104, where +1 corresponds to 1 nt of NM_003254.3 | + | + | – | [pdf] |
TNF | RDB07310 | pGL4-phTNF | cloned fragment: 31574419 to 31575594(NC_000006.12); relatively -1146 to +30, where +1 corresponds to 1 nt of NM_000594.4 | 42 | 30 | 31 | [pdf] |
TNFRSF10B | RDB07380 | pGL4-phTNFRSF10B | cloned fragment: 23070346 to 23069042(NC_000008.11); relatively -1315 to -10, where +1 corresponds to 1 nt of NM_003842.5 and relatively -1159 to +146, where +1 corresponds to 1 nt of NR_027140.1 | 40 | 65 | 228 | [pdf] |
TNFRSF10C | RDB07375 | pGL4-phTNFRSF10C | cloned fragment: 23101691 to 23103016(NC_000008.11); relatively -1123 to +203, where +1 corresponds to 1 nt of NM_003841.4 | 16 | ++ | 13 | [pdf] |
TNFRSF11B | RDB07533 | pGL4-phTNFRSF11B | cloned fragment: 118953586 to 118952112(NC_000008.11); relatively -1701 to -226, where +1 corresponds to 1 nt of NM_002546.4 | + | + | – | [pdf] |
TNFSF10 | RDB07526 | pGL4-phTNFSF10 | cloned fragment: 172524885 to 172523419(NC_000003.12); relatively -1455 to +12, where +1 corresponds to 1 nt of NM_003810.4 | 16.5 | ++ | + | [pdf] |
TNNC1 | RDB07517 | pGL4-phTNNC1 | cloned fragment: 52455364 to 52453996(NC_000003.12); relatively -1323 to +46, where +1 corresponds to 1 nt of NM_003280.3 | ++ | + | – | [pdf] |
TP53 | RDB07330 | pGL4-phTP53 | cloned fragment: 7688691 to 7687505(NC_000017.11); relatively -1141 to +46, where +1 corresponds to 1 nt of NM_000546.5 | 56 | 93 | 133 | [pdf] |
TP53AIP1 | RDB07410 | pGL4-phTP53AIP1 | cloned fragment: 128944146 to 128942842(NC_000011.10); relatively -747 to +558, where +1 corresponds to 1 nt of NM_022112.2 | + | 14 | 13 | [pdf] |
TP53TG5 | RDB07336 | pGL4-phTP53TG5 | cloned fragment: 45379557 to 45378288(NC_000020.11); relatively -1232 to +38, where +1 corresponds to 1 nt of NM_014477.3 | – | – | + | [pdf] |
TP63 | RDB07350 | pGL4-phTP63 | cloned fragment: 189630170 to 189631499(NC_000003.12); relatively -1219 to +111, where +1 corresponds to 1 nt of NM_003722.5 | ++ | + | 72.5 | [pdf] |
TP73 | RDB07381 | pGL4-phTP73 | cloned fragment: 3651265 to 3652596(NC_000001.11); relatively -1251 to +81, where +1 corresponds to 1 nt of NM_005427.4 | 10 | 14 | 41 | [pdf] |
TRIM22 | RDB07382 | pGL4-phTRIM22 | cloned fragment: 5688478 to 5689794(NC_000011.10); relatively -1109 to +208, where +1 corresponds to 1 nt of NM_006074.4 | ++ | + | + | [pdf] |
TTR | RDB07815 | pGL4-phTTR | cloned fragment: 31590468 to 31591928(NC_000018.10); relatively -1299 to +162, where +1 corresponds to 1 nt of NM_000371.3 | 10 | 88 | 22.6 | [pdf] |
TXN | RDB07518 | pGL4-phTXN | cloned fragment: 110257849 to 110256478(NC_000009.12); relatively -1209 to +163, where +1 corresponds to 1 nt of NM_003329.3 | 1676.1 | 197.3 | 95.2 | [pdf] |
VCAN | RDB07339 | pGL4-phVCAN | cloned fragment: 83470557 to 83471742(NC_000005.10); relatively -1117 to +69, where +1 corresponds to 1 nt of NM_004385.4 | – | – | + | [pdf] |
VEGFA | RDB07681 | pGL4-phVEGFA | cloned fragment: 43769068 to 43770372(NC_000006.12); relatively -1141 to +164, where +1 corresponds to 1 nt of NM_001025366.2 | 125.5 | 27 | 20.7 | [pdf] |
WRN | RDB07569 | pGL4-phWRN | cloned fragment: 31032123 to 31033442(NC_000008.11); relatively -1139 to +181, where +1 corresponds to 1 nt of NM_000553.5 | + | – | – | [pdf] |
WT1 | RDB07822 | pGL4-phWT1 | cloned fragment: 32436802 to 32435337(NC_000011.10 ); relatively -1263 to +203, where +1 corresponds to 1 nt of NM_000378.6 | ++ | – | – | [pdf] |
XPC | RDB07351 | pGL4-phXPC | cloned fragment: 14179875 to 14178575(NC_000003.12); relatively -1203 to +98, where +1 corresponds to 1 nt of NM_004628.4 | 141 | 341.8 | 482.5 | [pdf] |
(GRP0033e 2011.01.27 T.M.)
2019.09.17