Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Firefly Luciferase Construct


List of Construct

The Promoter series were validated by restriction enzyme digestion and confirmation of end sequences of insert DNA.

Sequencing Primer
pGL4-4174F: TAGCAAAATAGGCTGTCCCC
pGL4-136R: CTTCGAGTGGGTAGAATGGC

‘Activity’ indicates a value of the fold induction compared with empty vector.
-, less than 2
+, 2 to 5
++, 5 to 10
actual value, more than 10

Locus symbol Catalog No. Name of clone Gene of insert Other Aliases Size of PCR amplified DNA Activity in pdf
HeLa HepG2 Hep3B
pGL3 Control pGL3 Control Vector (SV40 promoter) 372.4 159.9 226.6
ABCA1 RDB07680 pGL4-phABCA1 Promoter collection, Human ABCA1 promoter TGD; ABC1; CERP; ABC-1; HDLDT1; FLJ14958; MGC164864; MGC165011 1,154 bp 63.5 51.0 11.3
ABCB1 RDB07315 pGL4-phABCB1 Promoter collection, Human ABCB1 promoter CLCS; MDR1; P-GP; PGY1; ABC20; CD243; GP170; MGC163296 1,219 bp +
ADM RDB07808 pGL4-phADM Promoter collection, Human ADM promoter AM 1,477 bp 588.5 55.5 50.2
ADRB2 RDB07532 pGL4-phADRB2 Promoter collection, Human ADRB2 promoter BAR; B2AR; ADRBR; ADRB2R; BETA2AR 1,446 bp 161.0 119.0 21.5
AGT RDB07683 pGL4-phAGT Promoter collection, Human AGT promoter ANHU; FLJ92595; FLJ97926; SERPINA8 1,494 bp
AHR RDB07724 pGL4-phAHR Promoter collection, Human AHR promoter bHLHe76 1,460 bp 225.3 67.8 49.6
AIFM2 RDB07332 pGL4-phAIFM2 Promoter collection, Human AIFM2 promoter AMID; PRG3; RP11-367H5.2 1,278 bp 105.0 268.0 177.0
AKT1 RDB07331 pGL4-phAKT1 Promoter collection, Human AKT1 promoter AKT; PKB; RAC; PRKBA; MGC99656; PKB-ALPHA; RAC-ALPHA 1,152 bp + +
ALB RDB07818 pGL4-phALB Promoter collection, Human ALB promoter PRO0883; PRO0903; PRO1341; DKFZp779N1935 1,471 bp + +
ALDOA RDB07512 pGL4-phALDOA Promoter collection, Human ALDOA promoter ALDA; GSD12; MGC10942; MGC17716; MGC17767 1,232 bp 15.5 80.4 13.7
ANTXR1 RDB07333 pGL4-phANTXR1 Promoter collection, Human ANTXR1 promoter ATR; TEM8; FLJ10601; FLJ11298; FLJ21776 1,189 bp 88.5 30.0 36.0
APAF1 RDB07316 pGL4-phAPAF1 Promoter collection, Human APAF1 promoter CED4; APAF-1; DKFZp781B1145 1,152 bp 31.0 101.0 43.0
APCS RDB07317 pGL4-phAPCS Promoter collection, Human APCS promoter SAP; PTX2; MGC88159 1,163 bp + + +
APEX1 RDB07729 pGL4-phAPEX1 Promoter collection, Human APEX1 promoter APE; APX; APE1; APEN; APEX; HAP1; REF1 1,460 bp 216.5 99.0 67.8
APOA1 RDB07684 pGL4-phAPOA1 Promoter collection, Human APOA1 promoter MGC117399 1,485 bp ++ 144.0 +
APOB RDB07527 pGL4-phAPOB Promoter collection, Human APOB promoter FLDB; LDLCQ4 1,436 bp 14.5 +
APOC3 RDB07303 pGL4-phAPOC3 Promoter collection, Human APOC3 promoter APOCIII; MGC150353 985 bp + 158.0 33.0
APOE RDB07556 pGL4-phAPOE Promoter collection, Human APOE promoter AD2; LPG; LDLCQ5; MGC1571 1,449 bp 88.3 ++ ++
APP RDB07692 pGL4-phAPP Promoter collection, Human APP promoter AAA; AD1; PN2; ABPP; APPI; CVAP; ABETA; CTFgamma 1,472 bp ++ + +
AQP3 RDB07311 pGL4-phAQP3 Promoter collection, Human AQP3 promoter GIL 1,219 bp 19.0 17.0 93.3
AR RDB07690 pGL4-phAR Promoter collection, Human AR promoter KD; AIS; TFM; DHTR; SBMA; HYSP1; NR3C4; SMAX1; HUMARA 1,490 bp 19.3 ++ ++
ARNT RDB07731 pGL4-phARNT Promoter collection, Human ARNT promoter HIF1B; TANGO; bHLHe2; HIF1BETA; HIF-1beta 1,462 bp 203.0 214.3 191.8
ASNS RDB07305 pGL4-phASNS Promoter collection, Human ASNS promoter TS11 1,253 bp 1104.0 254.0 6536.7
ATF2 RDB07712 pGL4-phATF2 Promoter collection, Human ATF2 promoter HB16; CREB2; TREB7; CRE-BP1; MGC111558 1,470 bp 140.0 82.8 67.6
ATF3 RDB07710 pGL4-phATF3 Promoter collection, Human ATF3 promoter 1,482 bp 40.0 54.5 43.3
ATR RDB07334 pGL4-phATR Promoter collection, Human ATR promoter FRP1; MEC1; SCKL; SCKL1 1,147 bp 105.5 408.0 308.0
B2M RDB07479 pGL4-phB2M Promoter collection, Human B2M promoter 1,420 bp 339.5 ++ +
BAI1 RDB07401 pGL4-phBAI1 Promoter collection, Human BAI1 promoter GDAIF; FLJ41988 1,368 bp + + +
BAK1 RDB07318 pGL4-phBAK1 Promoter collection, Human BAK1 promoter BAK; CDN1; BCL2L7; MGC3887; BAK-LIKE; MGC117255 1,193 bp 22.0 91.0 34.0
BCL2 RDB07567 pGL4-phBCL2 Promoter collection, Human BCL2 promoter Bcl-2 1,347 bp 21.0 ++ ++
BCL2L1 RDB07335 pGL4-phBCL2L1 Promoter collection, Human BCL2L1 promoter BCLX; BCL2L; BCLXL; BCLXS; Bcl-X; bcl-xL; bcl-xS; BCL-XL/S; DKFZp781P2092 1,214 bp ++ 56.0 147.0
BRCA1 RDB07296 pGL4-phBRCA1 Promoter collection, Human BRCA1 promoter IRIS; PSCP; BRCAI; BRCC1; PNCA4; RNF53; BROVCA1 1,130 bp 44.5 42.0 238.0
BRCA2 RDB07691 pGL4-phBRCA2 Promoter collection, Human BRCA2 promoter FAD; FACD; FAD1; GLM3; BRCC2; FANCB; FANCD; PNCA2; FANCD1; BROVCA2 1,474 bp 48.0 22.0 49.9
BTG2 RDB07402 pGL4-phBTG2 Promoter collection, Human BTG2 promoter PC3; TIS21; MGC126063; MGC126064 1,356 bp 285.0 1162.0 271.0
C12orf5 RDB07414 pGL4-phC12orf5 Promoter collection, Human C12orf5 promoter TIGAR 1,335 bp 63.0 234.0 138.0
CABLES1 RDB07337 pGL4-phCABLES1 Promoter collection, Human CABLES1 promoter IK3-1; CABLES; HsT2563; FLJ35924 1,222 bp +
CALCA RDB07291 pGL4-phCALCA Promoter collection, Human CALCA promoter CT; KC; CGRP; CALC1; CGRP1; CGRP-I; MGC126648 1,321 bp 271.0 105.0 322.0
CASP1 RDB07338 pGL4-phCASP1 Promoter collection, Human CASP1 promoter ICE; P45; IL1BC 1,169 bp ++ 16.0 20.0
CAV1 RDB07364 pGL4-phCAV1 Promoter collection, Human CAV1 promoter CGL3; BSCL3; VIP21; MSTP085 1,309 bp + +
CCND1 RDB07299 pGL4-phCCND1 Promoter collection, Human CCND1 promoter BCL1; PRAD1; U21B31; D11S287E 1,191 bp + 170.0 ++
CD44 RDB07685 pGL4-phCD44 Promoter collection, Human CD44 promoter IN; LHR; MC56; MDU2; MDU3; MIC4; Pgp1; CDW44; CSPG8; HCELL; HUTCH-I; ECMR-III; MGC10468 1,460 bp ++
CD55 RDB07539 pGL4-phCD55 Promoter collection, Human CD55 promoter CR; TC; DAF; CROM 1,432 bp ++ + +
CD82 RDB07416 pGL4-phCD82 Promoter collection, Human CD82 promoter R2; 4F9; C33; IA4; ST6; GR15; KAI1; SAR2; TSPAN27 1,319 bp 96.5 192.0 30.5
CDC2 RDB07816 pGL4-phCDC2 Promoter collection, Human CDC2 promoter CDC28A; P34CDC2; MGC111195; DKFZp686L20222; CDK1 1,477 bp 186.0 36.8 17.1
CDC25A RDB07709 pGL4-phCDC25A Promoter collection, Human CDC25A promoter CDC25A2 1,460 bp 148.3 33.5 72.4
CDK4 RDB07907 pGL4-phCDK4 Promoter collection, Human CDK4 promoter CMM3; PSK-J3; MGC14458 1,498 bp 108.5 43.3 27.5
CDKN1A RDB07302 pGL4-phCDKN1A Promoter collection, Human CDKN1A promoter P21; CIP1; SDI1; WAF1; CAP20; CDKN1; MDA-6; p21CIP1 1,203 bp 29.0 78.0 38.0
CEBPA RDB07812 pGL4-phCEBPA Promoter collection, Human CEBPA promoter CEBP; C/EBP-alpha 1,498 bp 66.5 33.5 35.1
CEBPE RDB07713 pGL4-phCEBPE Promoter collection, Human CEBPE promoter CRP1; C/EBP-epsilon 1,464 bp +
CGA RDB07456 pGL4-phCGA Promoter collection, Human CGA promoter HCG; LHA; FSHA; GPHa; TSHA; GPHA1; CG-ALPHA 1,273 bp 137.0 31.0 573.3
CHEK1 RDB07319 pGL4-phCHEK1 Promoter collection, Human CHEK1 promoter CHK1 1,208 bp 83.5 31.0 110.0
CHEK2 RDB07407 pGL4-phCHEK2 Promoter collection, Human CHEK2 promoter CDS1; CHK2; LFS2; RAD53; HuCds1; PP1425 1,312 bp 57.0 80.0 34.0
CHUK RDB07383 pGL4-phCHUK Promoter collection, Human CHUK promoter IKK1; IKKA; IKBKA; TCF16; NFKBIKA; IKK-alpha 1,315 bp 767.0 820.0 944.0
COL1A1 RDB07459 pGL4-phCOL1A1 Promoter collection, Human COL1A1 promoter OI4 1,260 bp 240.5 ++ 10.8
CREM RDB07811 pGL4-phCREM Promoter collection, Human CREM promoter ICER; hCREM-2; MGC17881; MGC41893; MGC111110 1,462 bp 195.5 110.5 120.8
CSF2 RDB07482 pGL4-phCSF2 Promoter collection, Human CSF2 promoter GMCSF; MGC131935; MGC138897 1,418 bp ++ +
CSNK2A1 RDB07483 pGL4-phCSNK2A1 Promoter collection, Human CSNK2A1 promoter CKII; CK2A1 1,402 bp 94.0 64.0 78.3
CTGF RDB07807 pGL4-phCTGF Promoter collection, Human CTGF promoter CCN2; NOV2; HCS24; IGFBP8; MGC102839 1,493 bp 248.5 102.5 16.6
CX3CL1 RDB07340 pGL4-phCX3CL1 Promoter collection, Human CX3CL1 promoter NTN; NTT; CXC3; CXC3C; SCYD1; ABCD-3; C3Xkine; fractalkine; neurotactin 1,236 bp +
CXCL12 RDB07687 pGL4-phCXCL12 Promoter collection, Human CXCL12 promoter IRH; PBSF; SDF1; TLSF; SDF1A; SDF1B; TPAR1; SCYB12 1,470 bp 21.0 27.3 14.3
CYP11A1 RDB07460 pGL4-phCYP11A1 Promoter collection, Human CYP11A1promoter CYP11A; P450SCC 1,218 bp + +
CYP1A1 RDB07541 pGL4-phCYP1A1 Promoter collection, Human CYP1A1 promoter AHH; AHRR; CP11; CYP1; P1-450; P450-C; P450DX 1,462 bp 590.7 43.8 33.5
DDC RDB07555 pGL4-phDDC Promoter collection, Human DDC promoter AADC 1,498 bp 21.3 +
DKK1 RDB07341 pGL4-phDKK1 Promoter collection, Human DKK1 promoter SK; DKK-1 1,166 bp 20.5 35.0 44.0
DRAM RDB07412 pGL4-phDRAM Promoter collection, Human DRAM promoter FLJ11259; DRAM1 1,346 bp 59.5 62.0 15.0
DUSP1 RDB07368 pGL4-phDUSP1 Promoter collection, Human DUSP1 promoter HVH1; MKP1; CL100; MKP-1; PTPN10 1,165 bp 173.8 176.8 1083.5
DUSP12 RDB07384 pGL4-phDUSP12 Promoter collection, Human DUSP12 promoter YVH1; DUSP1 1,310 bp 1593.0 1221.0 1937.0
E2F1 RDB07810 pGL4-phE2F1 Promoter collection, Human E2F1 promoter RBP3; E2F-1; RBAP1; RBBP3 1,473 bp 63.5 ++ 10.6
E2F2 RDB07904 pGL4-phE2F2 Promoter collection, Human E2F2 promoter E2F-2 1,469 bp 32.5 + +
E2F4 RDB07714 pGL4-phE2F4 Promoter collection, Human E2F4 promoter E2F-4 1,470 bp 891.0 289.0 317.1
EGFR RDB07398 pGL4-phEGFR Promoter collection, Human EGFR promoter ERBB; HER1; mENA; ERBB1; PIG61 1,340 bp 31.0 26.0 65.0
EGR1 RDB07369 pGL4-phEGR1 Promoter collection, Human EGR1 promoter TIS8; AT225; G0S30; NGFI-A; ZNF225; KROX-24; ZIF-268 1,310 bp 1594.3 605.0 5730.0
ELK1 RDB07908 pGL4-phELK1 Promoter collection, Human ELK1 promoter 1,470 bp 58.5 31.0 20.9
EPCAM RDB07367 pGL4-phEPCAM Promoter collection, HumanEPCAM promoter ESA; KSA; M4S1; MK-1; DIAR5; EGP-2; EGP40; KS1/4; MIC18; TROP1; EGP314; HNPCC8; GA733-2; TACSTD1 1,511 bp 28.5
EPHA2 RDB07342 pGL4-phEPHA2 Promoter collection, Human EPHA2 promoter ECK; ARCC2 1,163 bp 26.0 152.0 81.0
ESR1 RDB07528 pGL4-phESR1 Promoter collection, Human ESR1 promoter ER; ESR; Era; ESRA; NR3A1; DKFZp686N23123 1,438 bp ++ +
ETS1 RDB07819 pGL4-phETS1 Promoter collection, Human ETS1 promoter ETS-1; EWSR2; FLJ10768 1,475 bp 82.0 36.3 16.1
EZH2 RDB07370 pGL4-phEZH2 Promoter collection, Human EZH2 promoter ENX1; EZH1; KMT6; ENX-1; KMT6A; MGC9169 1,205 bp ++ ++ 65.5
F3 RDB07458 pGL4-phF3 Promoter collection, Human F3 promoter TF; TFA; CD142; FLJ17960 1,258 bp 40.0 13.0 10.0
F8 RDB07519 pGL4-phF8 Promoter collection, Human F8 promoter AHF; F8B; F8C; HEMA; FVIII; DXS1253E 1,376 bp +
FAS RDB07349 pGL4-phFAS Promoter collection, Human FAS promoter APT1; CD95; FAS1; APO-1; FASTM; ALPS1A; TNFRSF6 1,331 bp + ++
FDXR RDB07385 pGL4-phFDXR Promoter collection, Human FDXR promoter ADXR 1,353 bp 756.0 2295.0 921.0
FLT1 RDB07726 pGL4-phFLT1 Promoter collection, Human FLT1 promoter FLT; VEGFR1 1,466 bp 82.0 10.5 ++
FOS RDB07292 pGL4-phFOS Promoter collection, Human FOS promoter AP-1; C-FOS 1,261 bp 213.0 180.0 150.0
FOSL1 RDB07476 pGL4-phFOSL1 Promoter collection, Human FOSL1 promoter FRA; FRA1; fra-1 1,321 bp 12.5 ++ ++
GADD45A RDB07320 pGL4-phGADD45A Promoter collection, Human GADD45A promoter DDIT1; GADD45 1,225 bp 214.5 675.0 313.0
GADD45B RDB07529 pGL4-phGADD45B Promoter collection, Human GADD45B promoter MYD118; GADD45BETA; DKFZp566B133 1,506 bp 2122.7 268.5 132.5
GH2 RDB07309 pGL4-phGH2 Promoter collection, Human GH2 promoter GHL; GHV; GH-V; hGH-V 1,167 bp 92.0 12.0 90.0
GJA1 RDB07538 pGL4-phGJA1 Promoter collection, Human GJA1 promoter HSS; CX43; GJAL; ODDD; DFNB38 1,256 bp 16.4 ++ ++
GLI1 RDB07902 pGL4-phGLI1 Promoter collection, Human GLI1 promoter GLI 1,470 bp + + +
GML RDB07371 pGL4-phGML Promoter collection, Human GML promoter LY6DL 1,308 bp + ++
GSTP1 RDB07477 pGL4-phGSTP1 Promoter collection, Human GSTP1 promoter PI; DFN7; GST3; GSTP; FAEES3 1,243 bp 93.0 294.4 99.2
HDAC1 RDB07484 pGL4-phHDAC1 Promoter collection, Human HDAC1 promoter HD1; RPD3; GON-10; RPD3L1; DKFZp686H12203 1,471 bp 42.0 156.0 141.3
HIF1A RDB07693 pGL4-phHIF1A Promoter collection, Human HIF1A promoter HIF1; MOP1; PASD8; bHLHe78; HIF-1alpha; HIF1-ALPHA 1,469 bp 15.3 25.3 33.0
HIST2H2AB RDB07909 pGL4-phHIST2H2AB Promoter collection, Human HIST2H2AB promoter 1,461 bp 2425.0 100.8 102.3
HLA-DQB1 RDB07557 pGL4-phHLA-DQB1 Promoter collection, Human HLA-DQB1 promoter IDDM1; CELIAC1; HLA-DQB 1,468 bp 30.7 10.5 ++
HLA-DRA RDB07389 pGL4-phHLA-DRA Promoter collection, Human HLA-DRA promoter MLRW; FLJ51114; HLA-DRA1 1,423 bp 44.0 + ++
HLA-E RDB07388 pGL4-phHLA-E Promoter collection, Human HLA-E promoter MHC; QA1; EA1.2; EA2.1; HLA-6.2; DKFZp686P19218 1,160 bp 134.0 75.0 453.3
HMOX1 RDB07485 pGL4-phHMOX1 Promoter collection, Human HMOX1 promoter HO-1; HSP32; bK286B10 1,470 bp 45.5 ++ ++
HNF4A RDB07534 pGL4-phHNF4A Promoter collection, Human HNF4A promoter TCF; HNF4; MODY; MODY1; NR2A1; TCF14; HNF4a7; HNF4a8; HNF4a9; NR2A21; FLJ39654; HNF4alpha 1,485 bp + +
HPGD RDB07457 pGL4-phHPGD Promoter collection, Human HPGD promoter PGDH; PGDH1; 15-PGDH; SDR36C1 1,227 bp + + 13.3
HSP90AB1 RDB07321 pGL4-phHSP90AB1 Promoter collection, Human HSP90AB1 promoter HSPC2; HSPCB; D6S182; HSP90B; FLJ26984; HSP90-BETA 1,216 bp 503.5 560.0 596.0
HSPB1 RDB07530 pGL4-phHSPB1 Promoter collection, Human HSPB1 promoter CMT2F; HMN2B; HSP27; HSP28; Hsp25; SRP27; HS.76067; DKFZp586P1322 1,485 bp 27.0 56.3 ++
ICAM1 RDB07390 pGL4-phICAM1 Promoter collection, Human ICAM1 promoter BB2; CD54; P3.58 1,327 bp 17.5 ++ +
ID2 RDB07306 pGL4-phID2 Promoter collection, Human ID2 promoter GIG8; ID2A; ID2H; bHLHb26; MGC26389 1,473 bp 1140.0 316.0 2603.3
IFI16 RDB07372 pGL4-phIFI16 Promoter collection, Human IFI16 promoter PYHIN2; IFNGIP1; MGC9466 1,316 bp ++ ++ 61.5
IFNG RDB07297 pGL4-phIFNG Promoter collection, Human IFNG promoter IFG; IFI 1,216 bp 12.0 + 21.0
IFNGR1 RDB07708 pGL4-phIFNGR1 Promoter collection, Human IFNGR1 promoter CD119; IFNGR; FLJ45734 1,466 bp 213.0 167.5 176.9
IGF2 RDB07727 pGL4-phIGF2 Promoter collection, Human IGF2 promoter INSIGF; pp9974; C11orf43; FLJ22066; FLJ44734 1,460 bp 18.0 ++ +
IGFBP3 RDB07568 pGL4-phIGFBP3 Promoter collection, Human IGFBP3 promoter IBP3; BP-53 1,202 bp 119.0 49.5 22.2
IL1A RDB07682 pGL4-phIL1A Promoter collection, Human IL1A promoter IL1; IL-1A; IL1F1; IL1-ALPHA 1,494 bp
IL2 RDB07391 pGL4-phIL2 Promoter collection, Human IL2 promoter IL-2; TCGF; lymphokine 1,246 bp
IL2RA RDB07525 pGL4-phIL2RA Promoter collection, Human IL2RA promoter CD25; IL2R; TCGFR; IDDM10 1,473 bp
IL5 RDB07392 pGL4-phIL5 Promoter collection, Human IL5 promoter EDF; TRF; IL-5 1,277 bp
IL6 RDB07313 pGL4-phIL6 Promoter collection, Human IL6 promoter HGF; HSF; BSF2; IL-6; IFNB2 1,299 bp 94.5 ++
IL8 RDB07322 pGL4-phIL8 Promoter collection, Human IL8 promoter NAF; GCP1; LECT; LUCT; NAP1; CXCL8; GCP-1; LYNAP; MDNCF; MONAP; NAP-1 1,263 bp 376.5 1675.0 568.0
INS RDB07387 pGL4-phINS Promoter collection, Human INS promoter ILPR; IRDN; IDDM2; MODY10 1,263 bp + + ++
IRF3 RDB07821 pGL4-phIRF3 Promoter collection, Human IRF3 promoter 1,473 bp 37.0 37.0 27.8
JUN RDB07298 pGL4-phJUN Promoter collection, Human JUN promoter AP1; AP-1; c-Jun 1,164 bp 329.5 2332.0 770.0
KLK3 RDB07324 pGL4-phKLK3 Promoter collection, Human KLK3 promoter APS; PSA; hK3; KLK2A1 1,182 bp + ++ ++
KLKB1 RDB07373 pGL4-phKLKB1 Promoter collection, Human KLKB1 promoter PPK; KLK3 1,304 bp ++ ++ ++
LEF1 RDB07553 pGL4-phLEF1 Promoter collection, Human LEF1 promoter FLJ46390; TCF1ALPHA; DKFZp586H0919 1,505 bp ++ +
LEP RDB07688 pGL4-phLEP Promoter collection, Human LEP promoter OB; OBS; FLJ94114 1,457 bp ++ + +
LIF RDB07417 pGL4-phLIF Promoter collection, Human LIF promoter CDF; DIA; HILDA 1,304 bp ++ + +
LTA RDB07486 pGL4-phLTA Promoter collection, Human LTA promoter LT; TNFB; TNFSF1 1,408 bp
MAD1L1 RDB07374 pGL4-phMAD1L1 Promoter collection, Human MAD1L1 promoter MAD1; PIG9; TP53I9; TXBP181 1,379 bp 472.0 450.0 901.0
MAT2A RDB07393 pGL4-phMAT2A Promoter collection, Human MAT2A promoter MATA2; MATII; SAMS2 1,277 bp 237.5 247.0 381.5
MDM2 RDB07403 pGL4-phMDM2 Promoter collection, Human MDM2 promoter HDMX; hdm2; MGC5370; MGC71221 1,319 bp ++ 48.0 30.0
MDM4 RDB07418 pGL4-phMDM4 Promoter collection, Human MDM4 promoter HDMX; MDMX; MRP1; MGC132766; DKFZp781B1423 1,319 bp 669.0 885.0 475.0
MET RDB07554 pGL4-phMET Promoter collection, Human MET promoter HGFR; AUTS9; RCCP2; c-Met 1,457 bp + + +
MGP RDB07394 pGL4-phMGP Promoter collection, Human MGP promoter NTI; GIG36; MGLAP 1,292 bp ++
MIF RDB07913 pGL4-phMIF Promoter collection, Human MIF promoter GIF; GLIF; MMIF 1,460 bp 40.0 34.0 50.8
MKI67 RDB07323 pGL4-phMKI67 Promoter collection, Human MKI67 promoter KIA; MKI67 1,419 bp 60.5 153.0 46.0
MMP2 RDB07314 pGL4-phMMP2 Promoter collection, Human MMP2 promoter CLG4; MONA; CLG4A; TBE-1; MMP-II 1,160 bp + ++ ++
MMP3 RDB07535 pGL4-phMMP3 Promoter collection, Human MMP3 promoter SL-1; STMY; STR1; CHDS6; MMP-3; STMY1; MGC126102; MGC126103; MGC126104 1,364 bp + 18.1
MMP7 RDB07536 pGL4-phMMP7 Promoter collection, Human MMP7 promoter MMP-7; MPSL1; PUMP-1 1,386 bp +
MMP9 RDB07537 pGL4-phMMP9 Promoter collection, Human MMP9 promoter GELB; CLG4B; MMP-9; MANDP2 1,345 bp ++
MT1A RDB07513 pGL4-phMT1A Promoter collection, Human MT1A promoter MT1; MTC; MT1S; MGC32848 1,301 bp 61.8 59.1 25.2
MYB RDB07480 pGL4-phMYB Promoter collection, Human MYB promoter efg; Cmyb; c-myb; c-myb_CDS 1,435 bp ++ + 24.2
MYC RDB07325 pGL4-phMYC Promoter collection, Human MYC promoter MRTL; c-Myc; bHLHe39 1,267 bp ++ ++ 10.0
MYCN RDB07820 pGL4-phMYCN Promoter collection, Human MYCN promoter NMYC; ODED; MODED; N-myc; bHLHe37 1,469 bp 30.0 + ++
NFATC4 RDB07376 pGL4-phNFATC4 Promoter collection, Human NFATC4 promoter NFAT3; NF-ATc4 1,315 bp 33.0 19.0 47.0
NFIC RDB07399 pGL4-phNFIC Promoter collection, Human NFIC promoter CTF; NFI; CTF5; NF-I; MGC20153 1,152 bp 53.0 26.0 59.0
NFKB2 RDB07478 pGL4-phNFKB2 Promoter collection, Human NF-KB2 promoter p52; LYT10; LYT-10; NF-KB2 1,322 bp 718.8 83.5 44.5
NLRC4 RDB07406 pGL4-phNLRC4 Promoter collection, Human NLRC4 promoter CLAN; IPAF; CLAN1; CLANA; CLANB; CLANC; CLAND; CARD12; CLR2.1 1,318 bp + +
NME1 RDB07326 pGL4-phNME1 Promoter collection, Human NME1 promoter NB; AWD; NBS; GAAD; NM23; NDPKA; NDPK-A; NM23-H1 1,243 bp 606.5 622.0 709.0
NOS2 RDB07377 pGL4-phNOS2 Promoter collection, Human NOS2 promoter NOS; INOS; NOS2A; HEP-NOS 1,304 bp 21.0 ++ 13.0
NQO1 RDB07570 pGL4-phNQO1 Promoter collection, Human NQO1 promoter DTD; QR1; DHQU; DIA4; NMOR1; NMORI 1,399 bp 998.5 209.2 98.2
NR3C1 RDB07689 pGL4-phNR3C1 Promoter collection, Human NR3C1 promoter GR; GCR; GRL; GCCR 1,492 bp 13.7 + ++
NTS RDB07308 pGL4-phNTS Promoter collection, Human NTS promoter NN; NT; NT/N; NTS1; NMN-125 1,213 bp 138.0 38.0 303.3
PARP1 RDB07725 pGL4-phPARP1 Promoter collection, Human PARP1 promoter PARP; PPOL; ADPRT; ADPRT1; PARP-1; ADPRT 1; pADPRT-1 1,465 bp 67.5 56.5 79.6
PAX1 RDB07910 pGL4-phPAX1 Promoter collection, Human PAX1 promoter HUP48 1,490 bp 24.0 + +
PAX6 RDB07911 pGL4-phPAX6 Promoter collection, Human PAX6 promoter AN; AN2; MGDA; WAGR; D11S812E; MGC17209 1,460 bp ++ +
PAX8 RDB07906 pGL4-phPAX8 Promoter collection, Human PAX8 promoter 1,482 bp ++ +
PCNA RDB07365 pGL4-phPCNA Promoter collection, Human PCNA promoter MGC8367 1,203 bp 50.0 46.8 214.0
PDHA1 RDB07514 pGL4-phPDHA1 Promoter collection, Human PDHA1 promoter PDHA; PHE1A; PDHCE1A 1,455 bp 262.3 274.9 140.1
PENK RDB07293 pGL4-phPENK Promoter collection, Human PENK promoter 1,271 bp 11.0 ++ 40.0
PERP RDB07411 pGL4-phPERP Promoter collection, Human PERP promoter THW; KCP1; PIGPC1; KRTCAP1; dJ496H19.1; RP3-496H19.1 1,468 bp ++ 12.0 ++
PGR RDB07809 pGL4-phPGR Promoter collection, Human PGR promoter PR; NR3C3 1,471 bp 26.0 + ++
PLAT RDB07295 pGL4-phPLAT Promoter collection, Human PLAT promoter TPA; T-PA; DKFZp686I03148 1, 027 bp + + +
PLAU RDB07487 pGL4-phPLAU Promoter collection, Human PLAU promoter ATF; UPA; URK; u-PA 1,403 bp + 20.5 +
PLAUR RDB07312 pGL4-phPLAUR Promoter collection, Human PLAUR promoter CD87; UPAR; URKR 1,220 bp + +
PLK1 RDB07327 pGL4-phPLK1 Promoter collection, Human PLK1 promoter PLK; STPK13 1,221 bp 11.0 24.0 15.0
PML RDB07343 pGL4-phPML Promoter collection, Human PML promoter MYL; RNF71; PP8675; TRIM19 1,305 bp 15.5 115.0 174.0
POLD1 RDB07344 pGL4-phPOLD1 Promoter collection, Human POLD1 promoter CDC2; POLD 1,308 bp 200.0 145.0 238.0
POU5F1 RDB07912 pGL4-phPOU5F1 Promoter collection, Human POU5F1 promoter OCT3; OCT4; OTF3; OTF4; OTF-3; Oct-3; Oct-4; MGC22487 1,492 bp 28.5 + +
PPP1R15A RDB07307 pGL4-phPPP1R15A Promoter collection, Human PPP1R15A promoter GADD34 1,222 bp 1042.0 626.0 6010.0
PPP2R4 RDB07294 pGL4-phPPP2R4 Promoter collection, Human PPP2R4 promoter PP2A; PR53; PTPA; MGC2184 1,217 bp 498.0 123.0 870.0
PRKAB1 RDB07328 pGL4-phPRKAB1 Promoter collection, Human PRKAB1 promoter AMPK; HAMPKb; MGC17785 1,173 bp 559.5 1031.0 702.0
PSAP RDB07515 pGL4-phPSAP Promoter collection, Human PSAP promoter GLBA; SAP1; FLJ00245; MGC110993 1,418 bp 219.6 268.4 133.1
PTEN RDB07400 pGL4-phPTEN Promoter collection, Human PTEN promoter BZS; DEC; GLM2; MHAM; TEP1; MMAC1; PTEN1; 10q23del; MGC11227 1,442 bp + 75.0 ++
PTGS2 RDB07300 pGL4-phPTGS2 Promoter collection, Human PTGS2 promoter COX2; COX-2; PHS-2; PGG/HS; PGHS-2; hCox-2; GRIPGHS 1,253 bp 51.5 11.0 88.0
PTTG1 RDB07329 pGL4-phPTTG1 Promoter collection, Human PTTG1 promoter EAP1; PTTG; HPTTG; TUTR1; MGC126883; MGC138276 1,222 bp 43.5 14.0 29.0
RAD51 RDB07813 pGL4-phRAD51 Promoter collection, Human RAD51 promoter RECA; BRCC5; HRAD51; RAD51A; HsRad51; HsT16930 1,466 bp 41.5 12.3 12.8
RARB RDB07905 pGL4-phRARB Promoter collection, Human RARB promoter HAP; RRB2; NR1B2 1,463 bp ++ 27.3 13.4
RARG RDB07903 pGL4-phRARG Promoter collection, Human RARG promoter RARC; NR1B3 1,467 bp 14.0 + +
RB1 RDB07345 pGL4-phRB1 Promoter collection, Human RB1 promoter RB; pRb; OSRC; pp110; p105-Rb 1,333 bp 175.0 375.0 526.0
REL RDB07481 pGL4-phREL Promoter collection, Human RELpromoter C-Rel 1,438 bp 39.0 30.0 24.8
RELA RDB07366 pGL4-phRELA Promoter collection, Human RELA promoter p65; NFKB3; MGC131774 1,149 bp 136.8 73.0 399.0
RHOA RDB07404 pGL4-phRHOA Promoter collection, Human RHOA promoter ARHA; ARH12; RHO12; RHOH12 1,316 bp 258.0 296.0 422.0
RPRM RDB07409 pGL4-phRPRM Promoter collection, Human RPRM promoter REPRIMO; FLJ90327 1,300 bp 13.5 31.0 25.0
RRM2B RDB07346 pGL4-phRRM2B Promoter collection, Human RRM2B promoter P53R2; MGC42116; MGC102856; DKFZp686M05248 1,323 bp ++ 24.3 72.5
SCO2 RDB07415 pGL4-phSCO2 Promoter collection, Human SCO2 promoter SCO1L; MGC125823; MGC125825 1,315 bp 333.5 660.0 124.5
SERPINE1 RDB07461 pGL4-phSERPINE1 Promoter collection, Human SERPINE1 promoter PAI; PAI1; PAI-1; PLANH1 1,449 bp 234.5 127.0 33.5
SESN2 RDB07413 pGL4-phSESN2 Promoter collection, Human SESN2 promoter HI95; SES2; SEST2; DKFZp761M0212; DKFZp761M02121 1,321 bp 759.5 64.0 519.0
SFN RDB07408 pGL4-phSFN Promoter collection, Human SFN promoter YWHAS 1,352 bp 49.0 105.0 158.0
SLC2A1 RDB07814 pGL4-phSLC2A1 Promoter collection, Human SLC2A1 promoter PED; GLUT; DYT17; DYT18; GLUT1; GLUT1DS; MGC141895; MGC141896 1,301 bp + +
SMAD1 RDB07732 pGL4-phSMAD1 Promoter collection, Human SMAD1 promoter BSP1; JV41; JV4-1; MADH1; MADR1 1,467 bp 14.5 ++ ++
SMAD4 RDB07733 pGL4-phSMAD4 Promoter collection, Human SMAD4 promoter JIP; DPC4; MADH4 1,496 bp 222.0 126.8 94.5
SOD1 RDB07686 pGL4-phSOD1 Promoter collection, Human SOD1 promoter ALS; SOD; ALS1; IPOA; homodimer 1,471 bp 288.7 32.0 28.1
SP1 RDB07531 pGL4-phSP1 Promoter collection, Human SP1 promoter 1,487 bp 249.7 122.0 130.3
SP3 RDB07817 pGL4-phSP3 Promoter collection, Human SP3 promoter SPR2; DKFZp686O1631 1,462 bp 306.5 170.5 140.9
SPP1 RDB07552 pGL4-phSPP1 Promoter collection, Human SPP1 promoter OPN; BNSP; BSPI; ETA-1; MGC110940 1,422 bp + + +
SSTR2 RDB07378 pGL4-phSSTR2 Promoter collection, Human SSTR2 promoter 1,320 bp 48.0 57.0 116.0
STAT1 RDB07405 pGL4-phSTAT1 Promoter collection, Human STAT1 promoter ISGF-3; STAT91; DKFZp686B04100 1,313 bp 46.5 198.0 103.0
STAT4 RDB07711 pGL4-phSTAT4 Promoter collection, Human STAT1 promoter SLEB11 1,466 bp +
TBXAS1 RDB07347 pGL4-phTBXAS1 Promoter collection, Human TBXAS1 promoter TS; TXS; CYP5; THAS; TXAS; CYP5A1; GHOSAL; FLJ52771 1,321 bp ++ 46.3 25.5
TERT RDB07379 pGL4-phTERT Promoter collection, Human TERT promoter TP2; TRT; EST2; TCS1; hEST2 1,341 bp 76.0 27.0 90.0
TF RDB07540 pGL4-phTF Promoter collection, Human TF promoter PRO1557; PRO2086; DKFZp781D0156 1,478 bp ++ 35.8 ++
TFF1 RDB07511 pGL4-phTFF1 Promoter collection, Human TFF1 promoter pS2; BCEI; HPS2; HP1.A; pNR-2; D21S21 1,376 bp 13.2 85.0 13.7
TG RDB07304 pGL4-phTG Promoter collection, Human TG promoter TGN; AITD3 1,164 bp ++ + 30.0
TGFA RDB07348 pGL4-phTGFA Promoter collection, Human TGFA promoter TFGA 1,305 bp 23.3 36.0 124.0
TH RDB07301 pGL4-phTH Promoter collection, Human TH promoter TYH; DYT14; DYT5b 1,157 bp 68.0 14.0 66.7
THBS1 RDB07728 pGL4-phTHBS1 Promoter collection, Human THBS1 promoter TSP; THBS; TSP1; TSP-1; THBS-1 1,474 bp 171.5 33.5 12.3
TIMP1 RDB07516 pGL4-phTIMP1 Promoter collection, Human TIMP1 promoter EPA; EPO; HCI; CLGI; TIMP; FLJ90373 1,326 bp + +
TNF RDB07310 pGL4-phTNF Promoter collection, Human TNF promoter DIF; TNFA; TNFSF2; TNF-alpha 1,176 bp 42.0 30.0 31.0
TNFRSF10B RDB07380 pGL4-phTNFRSF10B Promoter collection, Human TNFRSF10B promoter DR5; CD262; KILLER; TRICK2; TRICKB; ZTNFR9; TRAILR2; TRICK2A; TRICK2B; TRAIL-R2; KILLER/DR5 1,305 bp 40.0 65.0 228.0
TNFRSF10C RDB07375 pGL4-phTNFRSF10C Promoter collection, Human TNFRSF10C promoter LIT; DCR1; TRID; CD263; TRAILR3; TRAIL-R3; DCR1-TNFR; MGC149501; MGC149502 1,329 bp 16.0 ++ 13.0
TNFRSF11B RDB07533 pGL4-phTNFRSF11B Promoter collection, Human TNFRSF11B promoter OPG; TR1; OCIF; MGC29565 1,475 bp + +
TNFSF10 RDB07526 pGL4-phTNFSF10 Promoter collection, Human TNFSF10 promoter TL2; APO2L; CD253; TRAIL; Apo-2L 1,467 bp 16.5 ++ +
TNNC1 RDB07517 pGL4-phTNNC1 Promoter collection, Human TNNC1 promoter TNC; TN-C; TNNC; CMD1Z; CMH13 1,369 bp ++ +
TP53 RDB07330 pGL4-phTP53 Promoter collection, Human TP53 promoter P53; LFS1; TRP53; FLJ92943 1,187 bp 56.0 93.0 133.0
TP53AIP1 RDB07410 pGL4-phTP53AIP1 Promoter collection, Human TP53AIP1 promoter P53AIP1 1,305 bp + 14.0 13.0
TP53TG5 RDB07336 pGL4-phTP53TG5 Promoter collection, Human TP53TG5 promoter CLG01; C20orf10 1,270 bp +
TP63 RDB07350 pGL4-phTP63 Promoter collection, Human TP63 promoter AIS; KET; LMS; NBP; RHS; p40; p51; p63; EEC3; OFC8; p73H; p73L; SHFM4; TP53L; TP73L; p53CP; TP53CP; B(p51A); B(p51B) 1,330 bp ++ + 72.5
TP73 RDB07381 pGL4-phTP73 Promoter collection, Human TP73 promoter P73 1,332 bp 10.0 14.0 41.0
TRIM22 RDB07382 pGL4-phTRIM22 Promoter collection, Human TRIM22 promoter RNF94; STAF50; GPSTAF50 1,317 bp ++ + +
TTR RDB07815 pGL4-phTTR Promoter collection, Human TTR promoter PALB; TBPA; HsT2651 1,461 bp 10.0 88.0 22.6
TXN RDB07518 pGL4-phTXN Promoter collection, Human TXN promoter TRX; TRX1; MGC61975; DKFZp686B1993 1,372 bp 1676.1 197.3 95.2
VCAN RDB07339 pGL4-phVCAN Promoter collection, Human VCAN promoter WGN; ERVR; GHAP; PG-M; WGN1; CSPG2; DKFZp686K06110 1,186 bp +
VEGFA RDB07681 pGL4-phVEGFA Promoter collection, Human VEGFA promoter VPF; VEGF; MVCD1; MGC70609 1,305 bp 125.5 27.0 20.7
WRN RDB07569 pGL4-phWRN Promoter collection, Human WRN promoter RECQ3; RECQL2; RECQL3; DKFZp686C2056 1,320 bp +
WT1 RDB07822 pGL4-phWT1 Promoter collection, Human WT1 promoter GUD; AWT1; WAGR; WT33; WIT-2 1,466 bp ++
XPC RDB07351 pGL4-phXPC Promoter collection, Human XPC promoter XP3; RAD4; XPCC 1,301 bp 141.0 341.8 482.5
From Entrez gene on 29.Sep.2010

go to Head


(GRP0033e 2011.01.27 T.M.)

2019.02.02