General Information
Rattus norvegicus genome BAC clones were developed by Dr. T. Serikawa, Kyoto Univ., RIKEN GSC and National BioResource Project. BAC end sequencing of BAC library of F344/Stm and LE/Stm strains has been completed. Researchers can search their interested clones through the F344 & LE Rat BAC browser.
Instruction: Searching BAC clone by the BAC browser
Ordering information
Forms
Forms | Description |
---|---|
Form A | Order Form Please specify ID of clone(s) ex. RNB1-456A01.Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). |
Form C | Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution.Please indicate “NBRP rat BAC clone RNB1 (F344/Stm) and RNB2 (LE/Stm)” as the BIOLOGICAL RESOURCE. Please put in the terms and condisions (Section 4) that |
![](https://dnaconda.riken.jp/images/arrow_down.png)
Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] |
Order Form for Bank Transfer Payment. [Word] |
Material Transfer Agreement (Category I MTA) [Word] For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
| Material Transfer Agreement (Category II MTA) [Word] For the use of our bioresource in research for the following cases:
|
![](https://dnaconda.riken.jp/images/arrow_down.png)
Send forms:
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Distribution fee per clone (as of April 1st, 2023): JPY 9,460 (For use in research for not-for-profit academic purpose). JPY 18,920 (For use in research for-profit-research purpose).
|
Distribution information
- NBRP Rat BAC clone(s) is shipped as stab agar culture with 50 microgram/ml ampicillin in an individual tube.
- When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 50 microgram/ml ampicillin. We hope you can find colonies.
- When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
- The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
- Please refer BAC Related Information for further information.
Related Information
Data Sheet
NBRP rat BAC clone F344/Stm (RNB1) information | ||
Species | Rattus norvegicus | |
Strain | F344/Stm | |
Clone information | ||
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] | |
Insert | SacI partial digestion | |
Host | DH10B, E. coli | |
Sequencing Primer | AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. | |
Nucleotide sequences | DNA Databank of Japan (DDBJ), DH508174-DH839445 Rattus_norvegicus_GSS_080325_1.seq.gz (331,272 entries), ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/ | |
Total number of clones (384-well plate) | RNB1, ca. 238,000 clones (620 plates) | |
Average length | 116 kb |
NBRP rat BAC clone LE/Stm (RNB2) information | ||
Species | Rattus norvegicus | |
Strain | LE/Stm | |
Clone information | ||
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] | |
Insert | SacI partial digestion | |
Host | DH10B, E. coli | |
Sequencing Primer | AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. | |
Nucleotide sequences | DNA Databank of Japan (DDBJ), FT000001-FT227486 Rattus_norvegicus_GSS_090401_1.seq.gz (227,486 entries), ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/Rattus_norvegicus_GSS_090401_1.seq.gz | |
Total number of clones (384-well plate) | RNB2, ca. 260,000 clones (677 plates) | |
Average length | 129 kb |
NCC Rat genome BAC clone
NCC rat BAC clone ACI/NJcl (NC1) information | ||
Species | Rattus norvegicus | |
Strain | F344/Jcl | |
Clone information | ||
Vector | pBACe3.6 (Cmr, U80929) | |
Host | DH10B, E. coli | |
Total number of clones (384-well plate) | NC1, ca. 109,000 clones (290 plates) | |
Average length | 111.1 kb |
NCC rat BAC clone F344/Jcl (NC2) information | ||
Species | Rattus norvegicus | |
Strain | ACI/NJcl | |
Clone information | ||
Vector | pBACe3.6 (Cmr, U80929) | |
Host | DH10B, E. coli | |
Total number of clones (384-well plate) | NC2, ca. 109,000 clones (290 plates) | |
Average length | 119.9 kb |
Reference
- Please visit the information site for articles published by using this materials, references and tips.
- The STAR Consortium, SNP and haplotype mapping for genetic analysis in the rat. Nat. Genet. 40, 560-566, 2008.
- Rat Genome Database
- National BioResource Project Rat
(GRP0040e 2008.02.14 T.M.)
2021.11.18