NBRP Rat (Rattus norvegicus) genome BAC clone

FacebookXBluesky

General Information

Rattus norvegicus genome BAC clones were developed by Dr. T. Serikawa, Kyoto Univ., RIKEN GSC and National BioResource Project. BAC end sequencing of BAC library of F344/Stm and LE/Stm strains has been completed. Researchers can search their interested clones through the F344 & LE Rat BAC browser.
Instruction: Searching BAC clone by the BAC browser

Ordering information

Forms

Forms Description
Form A Order Form
Please specify ID of clone(s) ex. RNB1-456A01.Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
Form C Material Transfer Agreement
We would like to ask a signature of the Authorized Representative of a recipient institution.Please indicate “NBRP rat BAC clone RNB1 (F344/Stm) and RNB2 (LE/Stm)” as the BIOLOGICAL RESOURCE.

Please put in the terms and condisions (Section 4) that
“In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested
The STAR Consortium, SNP and haplotype mapping for genetic analysis in the rat. Nat. Genet. 40, 560-566, 2008.”

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] [Example of order form]
Order Form for Bank Transfer Payment. [Word] [Example of order form]

Material Transfer Agreement (Category I MTA) [Word]

For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • Regarding Section 2(a):
    Please write your research purpose in detail. We need description specifically how and for what purpose you are going to use the DNA Bank resource(s). If the information is considered insufficient, we may ask you to add more or rewrite it.
    We can check whether the documents are filled out correctly or not in advance. Please email documents to us.
  • Regarding signature line:
    "Authorized Representative" is a person who is responsible for intellectual property rights. We request that the candidate is in one of the following positions, he/she can sign the MTA as the Authorized Representative. For anything unclear, please contact us by email.
    • College/University/Graduate School: President, Dean, Director or Head of Department
    • Research Institution: Director
    • Corporation: President, CEO, Director
    • Any officer appointed as Intellectual Property Administrator by the organization
    The MTA is a formal contract to be executed between institutions. Therefore, we ask your Authorized Representative to be an authority listed above.
Material Transfer Agreement (Category II MTA) [Word]

For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center (BRC),
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dna_sec.brc@riken.jp

Distribution fee per clone:
Please refer Fee and Payment
  • The cost of shipping containers, dry ice and freight will be charged separately. These are not included in the fee.
  • For details for fee and payment, please visit Information of Request for Distribution.

Distribution information

  • NBRP Rat BAC clone(s) is shipped as stab agar culture with 50 microgram/ml ampicillin in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 50 microgram/ml ampicillin. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
  • Please refer BAC Related Information for further information.

 

Related Information

data sheet

Data Sheet

NBRP rat BAC clone F344/Stm (RNB1) information
Species Rattus norvegicus
Strain F344/Stm
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), DH508174-DH839445 Rattus_norvegicus_GSS_080325_1.seq.gz (331,272 entries), ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/
Total number of clones (384-well plate) RNB1, ca. 238,000 clones (620 plates)
Average length 116 kb

 

NBRP rat BAC clone LE/Stm (RNB2) information
Species Rattus norvegicus
Strain LE/Stm
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), FT000001-FT227486 Rattus_norvegicus_GSS_090401_1.seq.gz (227,486 entries), ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/Rattus_norvegicus_GSS_090401_1.seq.gz
Total number of clones (384-well plate) RNB2, ca. 260,000 clones (677 plates)
Average length 129 kb

NCC Rat genome BAC clone

NCC rat BAC clone ACI/NJcl (NC1) information
Species Rattus norvegicus
Strain F344/Jcl
Clone information
Vector pBACe3.6 (Cmr, U80929)
Host DH10B, E. coli
Total number of clones (384-well plate) NC1, ca. 109,000 clones (290 plates)
Average length 111.1 kb

 

NCC rat BAC clone F344/Jcl (NC2) information
Species Rattus norvegicus
Strain ACI/NJcl
Clone information
Vector pBACe3.6 (Cmr, U80929)
Host DH10B, E. coli
Total number of clones (384-well plate) NC2, ca. 109,000 clones (290 plates)
Average length 119.9 kb

Reference

 


2025.05.05 (T.M. GRP0040e)



Comments are closed.