Drosophila BAC clone

General Information

Drosophila genome BAC clones were constructed and their BAC end sequences were analyzed by the Drosophila Genetic Resource Center of the Kyoto Institute of Technology Technology. Five Drosophila species, which were D. melanogaster, D. simulans, D. sechellia, D. auraria, and D. ananassae. D. melanogaster was selected as a control in order to measure the various qualities of the BAC libraries and the construction processes.

Forms for Distribution

Please find ID of individual clones using the following outside database.
D. melanogaster (keyword search)
D. ananassae (region search)
Five drosophila species (region search)

Forms required

Forms	Description
Form A	Order Form Please specify ID of clone(s) ex. DME1-003F18. Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
Form C	Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution. Please indicate “NBRP Drosophila BAC clone” as the BIOLOGICAL RESOURCE. Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Murakami et al., Genes Genet. Syst. 83, 245-256, 2008). In publishing the research results obtained by use of the Drosophila BAC clone, an acknowledgement to the National BioResource Project (NBRP) Drosophila, Japan is requested.” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format)

Forms

Description

Form A

Order Form Please specify ID of clone(s) ex. DME1-003F18.
Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).

Form C

Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution.
Please indicate “NBRP Drosophila BAC clone” as the BIOLOGICAL RESOURCE.
Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Murakami et al., Genes Genet. Syst. 83, 245-256, 2008). In publishing the research results obtained by use of the Drosophila BAC clone, an acknowledgement to the National BioResource Project (NBRP) Drosophila, Japan is requested.” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format)

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries

Order Form for Credit Card Payment. (Visa or Master Card only) [Word] [Example of order form]

Order Form for Bank Transfer Payment. [Word] [Example of order form]

Material Transfer Agreement (Category I MTA) [Word]

For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

Regarding Section 2(a):
Please write your research purpose in detail. We need description specifically how and for what purpose you are going to use the DNA Bank resource(s). If the information is considered insufficient, we may ask you to add more or rewrite it.
We can check whether the documents are filled out correctly or not in advance. Please email documents to us.
Regarding signature line:
"Authorized Representative" is a person who is responsible for intellectual property rights. We request that the candidate is in one of the following positions, he/she can sign the MTA as the Authorized Representative. For anything unclear, please contact us by email.
- College/University/Graduate School: President, Dean, Director or Head of Department
- Research Institution: Director
- Corporation: President, CEO, Director
- Any officer appointed as Intellectual Property Administrator by the organization
The MTA is a formal contract to be executed between institutions. Therefore, we ask your Authorized Representative to be an authority listed above.
Please ask us if applicable for the following use:
- For research to be conducted by for-profit organizations.
- For collaborative research between for-profit organization and not-for-profit organization.
- For research by not-for- organization outsourced and sponsored by for-profit organization.
- For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center (BRC),
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dna_sec.brc@riken.jp
FAX: (+81)-29-836-9120

Distribution fee per clone (as of April 1st, 2023):
JPY 9,460 (For use in research for not-for-profit academic purpose).
JPY 18,920 (For use in research for-profit-research purpose).

The cost of shipping containers, dry ice (if required) and freight will be charged separately. These are not included in the fee.
For details for fee and payment, please visit Information of Request for Distribution.

NBRP Drosophila BAC clone(s) is shipped as stab agar culture with 100 microgram/ml ampicillin in an individual tube.
When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 100 microgram/ml ampicillin. We hope you can find colonies.
When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.

Data Sheet

NBRP Drosophila auraria BAC clone DAB1

Strain information
Species	Drosophila auraria
Strain	A662
Sex	mixed
Clone information
Vector	pKS145 (SacI site, Amp^r, AB013921) [pdf]
Insert	SacI partial digestion
Host	DH10B, E. coli
Sequencing Primer	AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences	DNA Databank of Japan (DDBJ), AG909574-AG922586
Total number of clones (384-well plate)	ca. 15,000 clones (40 plates)
Average length	100 kb – 150 kb
Reference	Katsuhiko Murakami, Atsushi Toyoda, Masahira Hattori, Yoko Kuroki, Asao Fujiyama, Toshio Kojima, Muneo Matsuda, Yoshiyuki Sakaki and Masa-Toshi Yamamoto. BAC library construction and BAC end sequencing of five Drosophila species: the comparative map with the D. melanogaster genome. Genes Genet. Syst. Vol. 83 245-256 (2008). http://dx.doi.org/10.1266/ggs.83.245 National Bioresource Project Drosophila Database National Bioresource Project Drosophila BAC Database

NBRP Drosophila melanogaster BAC clone DME1

Strain information
Species	Drosophila melanogaster
Strain	Hikone-R
Sex	mixed
Clone information
Vector	pKS145 (SacI site, Amp^r, AB013921) [pdf]
Insert	SacI partial digestion
Host	DH10B, E. coli
Sequencing Primer	AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences	DNA Databank of Japan (DDBJ), AG922587-AG934292
Total number of clones (384-well plate)	ca. 15,000 clones (40 plates)
Average length	100 kb – 150 kb
Reference	Katsuhiko Murakami, Atsushi Toyoda, Masahira Hattori, Yoko Kuroki, Asao Fujiyama, Toshio Kojima, Muneo Matsuda, Yoshiyuki Sakaki and Masa-Toshi Yamamoto. BAC library construction and BAC end sequencing of five Drosophila species: the comparative map with the D. melanogaster genome. Genes Genet. Syst. Vol. 83 245-256 (2008). http://dx.doi.org/10.1266/ggs.83.245 National Bioresource Project Drosophila Database National Bioresource Project Drosophila BAC Database

NBRP Drosophila ananassae BAC clone DNB1

Strain information
Species	Drosophila ananassae
Strain	AABBg1
Sex	mixed
Clone information
Vector	pKS145 (SacI site, Amp^r, AB013921) [pdf]
Insert	SacI partial digestion
Host	DH10B, E. coli
Sequencing Primer	AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences	DNA Databank of Japan (DDBJ), AG934293-AG950339
Total number of clones (384-well plate)	ca. 15,000 clones (40 plates)
Average length	100 kb – 150 kb
Reference	Katsuhiko Murakami, Atsushi Toyoda, Masahira Hattori, Yoko Kuroki, Asao Fujiyama, Toshio Kojima, Muneo Matsuda, Yoshiyuki Sakaki and Masa-Toshi Yamamoto. BAC library construction and BAC end sequencing of five Drosophila species: the comparative map with the D. melanogaster genome. Genes Genet. Syst. Vol. 83 245-256 (2008). http://dx.doi.org/10.1266/ggs.83.245 National Bioresource Project Drosophila Database National Bioresource Project Drosophila BAC Database D. ananassae Genome Viewer at KYORIN-Fly

NBRP Drosophila sechellia BAC clone DSE1

Strain information
Species	Drosophila sechellia
Strain	ss01
Sex	mixed
Clone information
Vector	pKS145 (SacI site, Amp^r, AB013921) [pdf]
Insert	SacI partial digestion
Host	DH10B, E. coli
Sequencing Primer	AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences	DNA Databank of Japan (DDBJ), AG950340-AG965590
Total number of clones (384-well plate)	ca. 15,000 clones (40 plates)
Average length	100 kb – 150 kb
Reference	Katsuhiko Murakami, Atsushi Toyoda, Masahira Hattori, Yoko Kuroki, Asao Fujiyama, Toshio Kojima, Muneo Matsuda, Yoshiyuki Sakaki and Masa-Toshi Yamamoto. BAC library construction and BAC end sequencing of five Drosophila species: the comparative map with the D. melanogaster genome. Genes Genet. Syst. Vol. 83 245-256 (2008). http://dx.doi.org/10.1266/ggs.83.245 National Bioresource Project Drosophila Database National Bioresource Project Drosophila BAC Database

NBRP Drosophila simulans BAC clone DSM1

Strain information
Species	Drosophila simulans
Strain	Rakujuen RM13
Sex	mixed
Clone information
Vector	pKS145 (SacI site, Amp^r, AB013921) [pdf]
Insert	SacI partial digestion
Host	DH10B, E. coli
Sequencing Primer	AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences	DNA Databank of Japan (DDBJ), AG965591-AG981700
Total number of clones (384-well plate)	ca. 15,000 clones (40 plates)
Average length	100 kb – 150 kb
Reference	Katsuhiko Murakami, Atsushi Toyoda, Masahira Hattori, Yoko Kuroki, Asao Fujiyama, Toshio Kojima, Muneo Matsuda, Yoshiyuki Sakaki and Masa-Toshi Yamamoto. BAC library construction and BAC end sequencing of five Drosophila species: the comparative map with the D. melanogaster genome. Genes Genet. Syst. Vol. 83 245-256 (2008). http://dx.doi.org/10.1266/ggs.83.245 National Bioresource Project Drosophila Database National Bioresource Project Drosophila BAC Database

Articles Published by Using This Materials

Related site

go to top

(GRP0042e 2012.07.17 T.M.)

2021.11.18

Comments are closed.

Gene Engineering Division – DNA BANK –