Drosophila BAC clone

General Information

Drosophila genome BAC clones were constructed and their BAC end sequences were analyzed by the Drosophila Genetic Resource Center of the Kyoto Institute of Technology Technology. Five Drosophila species, which were D. melanogaster, D. simulans, D. sechellia, D. auraria, and D. ananassae. D. melanogaster was selected as a control in order to measure the various qualities of the BAC libraries and the construction processes.

Forms for Distribution

Please find ID of individual clones using the following outside database.
D. melanogaster (keyword search)
D. ananassae (region search)
Five drosophila species (region search)

Forms required

Forms Description
Form A Order Form Please specify ID of clone(s) ex. DME1-003F18.
Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
Form C Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution.
Please indicate “NBRP Drosophila BAC clone” as the BIOLOGICAL RESOURCE.
In the the Section 2(a), please write your purpose of use of clone in 10 to 20 words . Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Murakami et al., Genes Genet. Syst. 83, 245-256, 2008). In publishing the research results obtained by use of the Drosophila BAC clone, an acknowledgement to the National BioResource Project (NBRP) Drosophila, Japan is requested.” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format)

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
For Credit Card Payment. (Visa or Master Card only)
Order Form (Credit Card Payment) 
For bank transfer or check payment.
Order Form (Bank Transfer or Check Payment) 

Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

  • We ask a signature of the Authorized Representative of a recipient institution.
    In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.
  • Please ask us if applicable for the following use:
    • For research to be conducted by for-profit organizations.
    • For collaborative research between for-profit organization and not-for-profit organization.
    • For research by not-for- organization outsourced and sponsored by for-profit organization.
    • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Distribution fee per clone:
8,440 YEN (For use in research for not-for-profit academic purpose).
16,880 YEN (For use in research for-profit-research purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Information of Request for Distribution.
The distribution fee was revised from October 1, 2019

  • NBRP Drosophila BAC clone(s) is shipped as stab agar culture with 100 microgram/ml ampicillin in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 100 microgram/ml ampicillin. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.

Data Sheet

NBRP Drosophila auraria BAC clone DAB1

Strain information
Species Drosophila auraria
Strain A662
Sex mixed
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921.
AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG909574-AG922586
Total number of clones
(384-well plate)
ca. 15,000 clones (40 plates)
Average length 100 kb – 150 kb
Reference

 

NBRP Drosophila melanogaster BAC clone DME1

Strain information
Species Drosophila melanogaster
Strain Hikone-R
Sex mixed
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921.
AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG922587-AG934292
Total number of clones
(384-well plate)
ca. 15,000 clones (40 plates)
Average length 100 kb – 150 kb
Reference

 

NBRP Drosophila ananassae BAC clone DNB1

Strain information
Species Drosophila ananassae
Strain AABBg1
Sex mixed
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921.
AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG934293-AG950339
Total number of clones
(384-well plate)
ca. 15,000 clones (40 plates)
Average length 100 kb – 150 kb
Reference

 

NBRP Drosophila sechellia BAC clone DSE1

Strain information
Species Drosophila sechellia
Strain ss01
Sex mixed
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921.
AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG950340-AG965590
Total number of clones
(384-well plate)
ca. 15,000 clones (40 plates)
Average length 100 kb – 150 kb
Reference

 

NBRP Drosophila simulans BAC clone DSM1

Strain information
Species Drosophila simulans
Strain Rakujuen RM13
Sex mixed
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921.
AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG965591-AG981700
Total number of clones
(384-well plate)
ca. 15,000 clones (40 plates)
Average length 100 kb – 150 kb
Reference

 

Articles Published by Using This Materials

Related article

Related products

Related site

go to top

(GRP0042e 2012.07.17 T.M.)

2020.02.18



Comments are closed.