General Information
Drosophila genome BAC clones were constructed and their BAC end sequences were analyzed by the Drosophila Genetic Resource Center of the Kyoto Institute of Technology Technology. Five Drosophila species, which were D. melanogaster, D. simulans, D. sechellia, D. auraria, and D. ananassae. D. melanogaster was selected as a control in order to measure the various qualities of the BAC libraries and the construction processes.
Forms for Distribution
Please find ID of individual clones using the following outside database.
D. melanogaster (keyword search)
D. ananassae (region search)
Five drosophila species (region search)

Forms required
Forms | Description |
---|---|
Form A | Order Form Please specify ID of clone(s) ex. DME1-003F18. Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). |
Form C | Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution. Please indicate “NBRP Drosophila BAC clone” as the BIOLOGICAL RESOURCE. Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Murakami et al., Genes Genet. Syst. 83, 245-256, 2008). In publishing the research results obtained by use of the Drosophila BAC clone, an acknowledgement to the National BioResource Project (NBRP) Drosophila, Japan is requested.” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format) |

Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] [Example of order form] |
Order Form for Bank Transfer Payment. [Word] [Example of order form] |
Material Transfer Agreement (Category I MTA) [Word] For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
|

Send forms:
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp |
Distribution fee per clone (as of April 1st, 2023): JPY 9,460 (For use in research for not-for-profit academic purpose). JPY 18,920 (For use in research for-profit-research purpose).
|

- NBRP Drosophila BAC clone(s) is shipped as stab agar culture with 100 microgram/ml ampicillin in an individual tube.
- When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 100 microgram/ml ampicillin. We hope you can find colonies.
- When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
- The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
Data Sheet
NBRP Drosophila auraria BAC clone DAB1
Strain information | |
Species | Drosophila auraria |
Strain | A662 |
Sex | mixed |
Clone information | |
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] |
Insert | SacI partial digestion |
Host | DH10B, E. coli |
Sequencing Primer | AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG909574-AG922586 |
Total number of clones (384-well plate) |
ca. 15,000 clones (40 plates) |
Average length | 100 kb – 150 kb |
Reference |
|
NBRP Drosophila melanogaster BAC clone DME1
Strain information | ||
Species | Drosophila melanogaster | |
Strain | Hikone-R | |
Sex | mixed | |
Clone information | ||
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] | |
Insert | SacI partial digestion | |
Host | DH10B, E. coli | |
Sequencing Primer | AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
|
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG922587-AG934292 | |
Total number of clones (384-well plate) |
ca. 15,000 clones (40 plates) | |
Average length | 100 kb – 150 kb | |
Reference |
|
NBRP Drosophila ananassae BAC clone DNB1
Strain information | |
Species | Drosophila ananassae |
Strain | AABBg1 |
Sex | mixed |
Clone information | |
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] |
Insert | SacI partial digestion |
Host | DH10B, E. coli |
Sequencing Primer | AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG934293-AG950339 |
Total number of clones (384-well plate) |
ca. 15,000 clones (40 plates) |
Average length | 100 kb – 150 kb |
Reference |
|
NBRP Drosophila sechellia BAC clone DSE1
Strain information | |
Species | Drosophila sechellia |
Strain | ss01 |
Sex | mixed |
Clone information | |
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] |
Insert | SacI partial digestion |
Host | DH10B, E. coli |
Sequencing Primer | AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG950340-AG965590 |
Total number of clones (384-well plate) |
ca. 15,000 clones (40 plates) |
Average length | 100 kb – 150 kb |
Reference |
|
NBRP Drosophila simulans BAC clone DSM1
Strain information | |
Species | Drosophila simulans |
Strain | Rakujuen RM13 |
Sex | mixed |
Clone information | |
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] |
Insert | SacI partial digestion |
Host | DH10B, E. coli |
Sequencing Primer | AFF forward primer, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR reverse primer, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG965591-AG981700 |
Total number of clones (384-well plate) |
ca. 15,000 clones (40 plates) |
Average length | 100 kb – 150 kb |
Reference |
|
2025.05.05 (T.M. GRP0042e)