Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

C57BL/6N (B6N) mouse BAC clone


General Information

The Gene Engineering Division has constructed a BAC library of the B6N substrain and the RIKEN BioResource Research Center accomplished BAC end sequencing of B6N and register the sequence data with DDBJ in a collaboration with the National Institute of Genetics under the Genome Information Upgrading Program of MEXT NBRP. The B6N Mouse BAC library consisted of 128,000 clones representing 90.2% of actual coverage of haploid genome.
The germ cell competent C57BL/6N ES cell lines are available from the Cell Engineering Division of RIKEN BRC.
 

Individual clone ID can be get on the Mouse BAC browser.
Instruction: Searching BAC clone by the BAC browserB6N BAC

Ordering information

Forms

Forms Description
Form A Order Form
Specify ID of clone(s) ex. B6Ng01-122P06 in the Name of clone column.
Leave Catalog no. column empty.
Complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express and others).
Form C Material Transfer Agreement
We would like to ask a signature of the Authorized Representative of a recipient institution.Indicate “NBRP B6N mouse BAC clone” as the BIOLOGICAL RESOURCE.

In the the Section 2(a), please write your purpose of use of clone in 10 to 20 words.

Please put in the terms and condisions (Section 4) that
“In publishingthe research results to be obtained by use of the B6N mouse BAC clone, an acknowledgment to the RIKEN BioResource Research Center is requested.”

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
For Credit Card Payment. (Visa or Master Card only)
Order Form (Credit Card Payment) 
For bank transfer or check payment.
Order Form (Bank Transfer or Check Payment) 

Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • We ask a signature of the Authorized Representative of a recipient institution.
    In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.
Material Transfer Agreement (Category II MTA) [Word]
For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Please visit further information of distribution and fees.
Distribution fee per clone:
8,640 YEN (For use in research for not-for-profit academic purpose).
17,280 YEN (For use in research for-profit-research purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Information of Request for Distribution.

Distribution information

  • B6N mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
  • Please refer BAC Related Information for further information.

Related Information

Data Sheet

C57BL/6N (B6N) mouse BAC clone
Strain information
Species Mus musculus domesticus
Strain C57BL/6NCrlCrlj, male
Clone information
Vector pBACe3.6 (Cmr, U80929), EcoRI site
Insert EcoRI partial digestion
Host DH10B, E. coli
Sequence primers 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC
3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC
Nucleotide Sequences DNA Databank of Japan (DDBJ),
DH839446 to DH961576, and
GA000001 to GA131507
Total number of clones 128,007
Actual Genome Coverage ca. 90.2%

Reference


(GRP0031e 2010.05.06 T.M.)

2019.02.04