C57BL/6N (B6N) mouse BAC clone

FacebookXBluesky

General Information

The Gene Engineering Division has constructed a BAC library of the B6N substrain and the RIKEN BioResource Research Center (BRC) accomplished BAC end sequencing of B6N and register the sequence data with DDBJ in a collaboration with the National Institute of Genetics under the Genome Information Upgrading Program of MEXT NBRP. The B6N Mouse BAC library consisted of 128,000 clones representing 90.2% of actual coverage of haploid genome.
The germ cell competent C57BL/6N ES cell lines are available from the Cell Engineering Division of BRC.
 

Individual clone ID can be get on the Mouse BAC browser.
Instruction: Searching BAC clone by the BAC browserB6N BAC

Ordering information

Order Form

  • Specify ID of clone(s) ex. B6Ng01-122P06 in the Name of clone column.
    Leave Catalog no. column empty.
Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] [Example of order form]
Order Form for Bank Transfer Payment. [Word] [Example of order form]

Material Transfer Agreement

  • Indicate “NBRP B6N mouse BAC clone” as the BIOLOGICAL RESOURCE.
  • Please put in the terms and condisions (Section 4) that
    “In publishingthe research results to be obtained by use of the B6N mouse BAC clone, an acknowledgment to the RIKEN BioResource Research Center is requested.”
Material Transfer Agreement (Category I MTA) [Word]

For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • Regarding Section 2(a):
    Please write your research purpose in detail. We need description specifically how and for what purpose you are going to use the DNA Bank resource(s). If the information is considered insufficient, we may ask you to add more or rewrite it.
    We can check whether the documents are filled out correctly or not in advance. Please email documents to us.
  • Regarding signature line:
    "Authorized Representative" is a person who is responsible for intellectual property rights. We request that the candidate is in one of the following positions, he/she can sign the MTA as the Authorized Representative. For anything unclear, please contact us by email.
    • College/University/Graduate School: President, Dean, Director or Head of Department
    • Research Institution: Director
    • Corporation: President, CEO, Director
    • Any officer appointed as Intellectual Property Administrator by the organization
    The MTA is a formal contract to be executed between institutions. Therefore, we ask your Authorized Representative to be an authority listed above.
Material Transfer Agreement (Category II MTA) [Word]

For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center (BRC),
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dna_sec.brc@riken.jp

Please visit further information of distribution and fees.
Distribution fee per clone:
Please refer Fee and Payment
  • The cost of shipping containers, dry ice and freight will be charged separately. These are not included in the fee.
  • For details for fee and payment, please visit Information of Request for Distribution.

Distribution information

  • B6N mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
  • Please refer BAC Related Information for further information.

Related Information


data sheet

Data Sheet

C57BL/6N (B6N) mouse BAC clone
Strain information
Species Mus musculus domesticus
Strain C57BL/6NCrlCrlj, male
Clone information
Vector pBACe3.6 (Cmr, U80929), EcoRI site
Insert EcoRI partial digestion
Host DH10B, E. coli
Sequence primers 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC
3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC
Nucleotide Sequences DNA Databank of Japan (DDBJ),
DH839446 to DH961576, and
GA000001 to GA131507
Total number of clones 128,007
Actual Genome Coverage ca. 90.2%

Reference


2025.05.05 (T.M. GRP0031e)



Comments are closed.