Sequencing and PCR primer

Sequencing & PCR primers

Please contact DNA Bank for any commnets. Thank you.

Pr0002 5’Retro(pFB-5′) 5′ GGCTGCCGACCCCGGGGGTGG 3′
Pr0405 Ago2 1468-1487 5′ AGATCTCGAGAGACGCCGGC 3′
Pr0401 Ago2 1521-1540 5′ CCTGAAGAACACGTATGCGG 3′
Pr0540 Akaluc 1215-1243 5′ AACGCTCTCATCGACAAGG 3′
Pr0539 Akaluc 576-593 5′ CGCCCTGATCATGAACAGT 3′
Pr0359 B95.delta_fabR#3 5′ CCAAAGGCGGGAGTGTGA 3′
Pr0360 B95.delta_fabR#4 5′ CCAAAGGCGGGAGTGTGT 3′
Pr0361 B95.delta_fabR#5 5′ GAGACCGAGGTGCGGAT 3′
Pr0362 B95.delta_fabR#6 5′ GAGACCGAGGTGCGGAC 3′
Pr0353 B95.delta_prfA#1 5′ AGCAAGTTCGCGATGAGTTAACC 3′
Pr0354 B95.delta_prfA#2 5′ ACCCCGGTTAAATGAGCAATGG 3′
Pr0512 beta-gro_rev 5′ GTCCATGGTGATACAAGGGA 3′
Pr0942 chimeric in-H_R 5′ TCTTAGCGCAGAAGTCATGCC 3′
Pr0444 chimeric intron 3-prime 5′ TACTGACATCCACTTTGCCT 3′
Pr0644 cmlc2pro_R 5′ ATCGGTTCTCTGTATTTGAC 3′
Pr0733 cmr6h_up_F 5′ GCAACCCCCAGGAGCTGAAG 3′
Pr0426 eSpCas9(1.1) 5′ CAGGAACTGGACATCAACCG 3′
Pr0551 hsFLI1_F2 5′ aggggcacaaacgatcagta 3′
Pr0498 hsp70 promoter-rev 5′ AGCTGCGCTTGTTTATTTGC 3′
Pr0278 KITseq3(1050-) 5′ AGGCATATCCCAAACCGGAG 3′
Pr0006 LargeT antigen innerF1 5′ GATGTATAGTGCCTTGACTAGAGATCC 3′
Pr0040 M13 Forward(-20) 5′ TTGTAAAACGACGGGCCAGT 3′
Pr0042 M13-reverse 5′ AAACAGCTATGACCATGTTCA 3′
Pr0520 mCharry-check_F 5′ TGGAGGGCTCCGTGAACG 3′
Pr0521 mCharry-check_R 5′ TGTAGATGAACTCGCCGTCC 3′
Pr0522 mCharry-mut_F 5′ ACGGCCACGAGTTCGAGT 3′
Pr0792 mCherry-C_R2 5′ TTCTTGGCCTTGTAGGTG 3′
Pr0526 mCherry-check_R2 5′ ATCCCCGACTACTTGAAGCTGT 3′
Pr0529 mCherry-check_R3 5′ TCCCCCGACTACTTGAAGCTG 3′
Pr0527 mCherry-check_R4 5′ CAGCTTCAAGTAGTCGGGGA 3′
Pr0523 mCherry-check-wt_F 5′ GGCCACGAGTTCGAGA 3′
Pr0532 mCherry-check-wt_F2 5′ acGGCCACGAGTTCGAGA 3′
Pr0398 mCherry-N_rev 5′ GTTCACGGAGCCCTCCATGT 3′
Pr0045 ME:1250RV (Sugano R) 5′ TGTGGGAGGTTTTTTCTCTA 3′
Pr0577 mTurquoise2-M_F 5′ AAGGCCAACTTCAAGATCCG 3′
Pr0195 NM_005228.3_3745..3762 5′ CTGGACAACCCTGACTAC 3′
Pr0196 NM_005228.3_520..502 5′ CAATGAGGACATAACCAGC 3′
Pr0049 nmt1-rev 5′ AGACATTCCTTTTACCCTTA 3′
Pr0505 nmt1ter_R2 5′ AGTACTCGTTGTCGGAGATC 3′
Pr0442 OI b-actin S74868 (2017-2035) 5′ GCAGATGGGCGTGTCTTTG 3′
Pr0241 OsTIR1 codon plus_F1 5′ TCTGCTGAGAACCCCTAACC 3′
Pr0332 Pause site 5′ TAGGCTGTCCCCAGTGCAAG 3′
Pr0120 Pause site_R 5′ GTTCTGGCACCTGCACTTGC 3′
Pr0135 pAxcwit2-Rv 5′ GCGTAACCGAGTAAGATTT 3′
Pr0750 pBS423_seq3_2 5′ TGCGACGATGACTACTCCCA 3′
Pr0751 pBS423_seq3_3 5′ CAACGAATATGTGCAGGGGA 3′
Pr0078 pGL3basic_4406F 5′ TATCTCGGTCTATTCTTTTG 3′
Pr0236 pPolyhedrin_F 5′ TTAAAATGATAACCATCTCG 3′
Pr0669 RDB15137#1 5′ TGCTCACCATatctgcag 3′
Pr0098 Rev primer 5′ GGAAACAGCTATGACCATG 3′
Pr0099 reverse 5′ GGAAACAGCTATGACCATG 3′
Pr0264 Rluc8.6-535-C_F 5′ ACGCTCCAGATGAAATGG 3′
Pr0265 Rluc8-m1dN3-C_F 5′ ACTTCCTCCAGGAGGACG 3′
Pr0108 SV40pA3’element Reverse 5′ CTCTGACTTGAGCGTCGATTT 3′
Pr0155 T7 terminator 5′ GCTAGTTATTGCTCAGCGG 3′
Pr0333 TetOne oligo 1 5′ accccacagtggggcaagctGAGTCAGTGAGCGAGGAAGCTCGGG 3′
Pr0334 TetOne oligo 2 5′ tggaaaaggcgcaaccccaaCCCCGAAAAGTGCCACCTGACGTCG 3′
Pr0122 TriEx Down primer 5′ TCGATCTCAGTGGTATTTGTG 3′
Pr0457 W01A019C14_5_1420bp 5′ GGTATCTTTTGCAGTTAAGAG 3′
Pr0456 W01A019C14_5_500bp 5′ TTGGGCAGAACTGATTGTAGTCC 3′

go to top

(MAN0035e 2011.01.12 T.M.)


Comments are closed.