Thermus thermophilus Expression & Disruption plasmid

Thermus thermophilus HB8 Expression and Disruption plasmids were constructed by “Whole-Cell Project of a Model Organism, Thermus thermophilus HB8” and deposited by Dr. Seiki Kuramitsu.


Expression plasmid of Thermus thermophilus HB8 proteins in E. coli

Data Sheet data sheet

Resource name Thermus thermophilus HB8 expression plasmid
Vector pET-11a (Ampr), pET-11b (Ampr) or pET-3a (Ampr)
Insert Genomic DNA of Thermus thermophilus strain HB8
Host Plasmids were amplified using DH5alpha, E. coli
Individual clone data Available at Thermus thermophilus gene plasmid
Reference
  • Yokoyama, S., Hirota, H., Kigawa, T., Yabuki, T., Shirouzu, M., Terada, T., Ito, Y., Matsuno, Y. Kuroda, Y., Nishimura, Y., Kyogoku, Y., Miki, K., Masui, R., Kuramitsu, S. (2000) Structual genomics projects in Japan. Nature Struct. Biol. 7, 943-945.
  • Structural-Biological Whole Cell Project
Related information Please visit Informaion site for articles published by using this materials, references and tips.

Disruption plasmid of Thermus Thermophilus HB8 gene

The gene disruptant of T. thermophils HB8 can be easily prepared by adding this plasmid into the culture medium. The target gene in this plasmid was replaced by the thermostable kanamycin resistant gene from Staphylococcus aureus. The length of the homologous region outside of the target gene is about 500 bp (only 10 bp of the target geneare left in both sides) .

Data Sheet data sheet

Resource name Thermus thermophilus HB8 Disruption plasmid
Vector pGEM derivative (Ampr)
Insert Genomic DNA of Thermus thermophilus strain HB8, thermostable kanamycin resistant gene from Staphylococcus aureus
Host Plasmids were amplified using E. coli host strain for unstable inserts (ex. Stbl2)
Individual clone data Available at Thermus thermophilus gene plasmid
Sequencing Primer
  • Vector toward insert
    T7long: cgccaagctctaatacgactcactataggg
    SP6: atttaggtgacactatag
  • Km toward insert
    7723km F:aatttctggaatggggttca
    7723km R:gattgcgatgctgattcgt
Related information Please visit Informaion site for articles published by using this materials, references and tips.

Disruption method

Directed evolution of thermostable kanamycin-resistance gene: a convenient selection marker for Thermus thermophilus.

Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S., Kagamiyama, H.
J. Biochem. 126 (5): 951-956 (1999). PubMed PMID 10544290.

Catalog no. Name of resource Description
RDB03436 pUC18-HTK (with promoter) Expression vector of Thermus highly thermostable kanamycin nucleotidyltransferase (HTK) gene

Depositor: Dr. Jun Hoseki

Related article

  • Molecular mechanisms of the whole DNA repair system: a comparison of bacterial and eukaryotic systems.
    Shimada, A., Inoue, M., Iino, H., Wakamatsu, T., Fukui, K., Nakagawa, N., Masui, R., Kuramitsu, S. (2010)
    J. Nucleic Acids 2010: 179594
  • Increased Rigidity of Domain Structures Enhances the Stability of a Mutant Enzyme Created by Directed Evolution
    Hoseki, J., Okamoto, A., Takada, N., Suenaga, A., Funatsugi, N., Konagaya, A., Taiji, M., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2003)
    Biochemistry 42, 14469-14475.
  • Disruption of Thermus thermophilus Genes by Homologous Recombination Using A Thermostable Kanamycin-Resistant Marker
    Hashimoto, Y., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2001)
    FEBS Lett. 506, 231-234.
  • Directed Evolution of Thermostable Kanamycin-Resistant Gene Products in an Extremely Thermophilic Bacterium, Thermus thermophilus
    Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S. and Kagamiyama, H. (1999)
    J. Biochem. 126, 951-956.

Ordering information

in Japanese

Forms

Please specify ID (ex. TEx01A01, TDs01A01) of individual clone(s).

Please indicate Terms and Conditions for Distribution in MTA as follows:

In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, the USER is expected to cite the following literature.
(Yokoyama et al., 2000, Nature Struct. Biol. 7, 943-945).

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Fom for Credit Card Payment. (Visa or Master Card only) [Word] 
Order Form for Bank Transfer Payment. [Word] 

Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • We ask a signature of the Authorized Representative of a recipient institution.
    In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.
Material Transfer Agreement (Category II MTA) [Word]
For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms to:
The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Please visit further information of distribution and fees.

Distribution fee per clone:
8,440 YEN (For use in research for not-for-profit academic purpose).
16,880 YEN (For use in research for-profit-research purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Information of Request for Distribution.
The distribution fee was revised from October 1, 2019

TIPS

  • Strain Thermus thermophilus HB8 (JCM 10941T) of BRC-JCM
  • Genomic DNA (cat# JGD05989) of Thermus thermophilus HB8 (JCM 10941T)

go to Head


(GRP0051e 2012.10.22 T.M.)

2021.03.14



Comments are closed.