Thermus thermophilus Expression & Disruption plasmid

FacebookXBluesky

Thermus thermophilus HB8 Expression and Disruption plasmids were constructed by “Whole-Cell Project of a Model Organism, Thermus thermophilus HB8” and deposited by Dr. Seiki Kuramitsu.


Expression plasmid of Thermus thermophilus HB8 proteins in E. coli

Data Sheet data sheet

Resource name Thermus thermophilus HB8 expression plasmid
Vector pET-11a (Ampr), pET-11b (Ampr) or pET-3a (Ampr)
Insert Genomic DNA of Thermus thermophilus strain HB8
Host Plasmids were amplified using DH5alpha, E. coli
Individual clone data Available at Thermus thermophilus gene plasmid
Reference
  • Yokoyama, S., Hirota, H., Kigawa, T., Yabuki, T., Shirouzu, M., Terada, T., Ito, Y., Matsuno, Y. Kuroda, Y., Nishimura, Y., Kyogoku, Y., Miki, K., Masui, R., Kuramitsu, S. (2000) Structual genomics projects in Japan. Nature Struct. Biol. 7, 943-945.
  • Structural-Biological Whole Cell Project
Related information Please visit Informaion site for articles published by using this materials, references and tips.

Disruption plasmid of Thermus Thermophilus HB8 gene

The gene disruptant of T. thermophils HB8 can be easily prepared by adding this plasmid into the culture medium. The target gene in this plasmid was replaced by the thermostable kanamycin resistant gene from Staphylococcus aureus. The length of the homologous region outside of the target gene is about 500 bp (only 10 bp of the target geneare left in both sides) .

Data Sheet data sheet

Resource name Thermus thermophilus HB8 Disruption plasmid
Vector pGEM derivative (Ampr)
Insert Genomic DNA of Thermus thermophilus strain HB8, thermostable kanamycin resistant gene from Staphylococcus aureus
Host Plasmids were amplified using E. coli host strain for unstable inserts (ex. Stbl2)
Individual clone data Available at Thermus thermophilus gene plasmid
Sequencing Primer
  • Vector toward insert
    T7long: cgccaagctctaatacgactcactataggg
    SP6: atttaggtgacactatag
  • Km toward insert
    7723km F:aatttctggaatggggttca
    7723km R:gattgcgatgctgattcgt
Related information Please visit Informaion site for articles published by using this materials, references and tips.

Disruption method

Directed evolution of thermostable kanamycin-resistance gene: a convenient selection marker for Thermus thermophilus.

Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S., Kagamiyama, H.
J. Biochem. 126 (5): 951-956 (1999). PubMed PMID 10544290.

Catalog no. Name of resource Description
RDB03436 pUC18-HTK (with promoter) Expression vector of Thermus highly thermostable kanamycin nucleotidyltransferase (HTK) gene

Depositor: Dr. Jun Hoseki

Related article

  • Molecular mechanisms of the whole DNA repair system: a comparison of bacterial and eukaryotic systems.
    Shimada, A., Inoue, M., Iino, H., Wakamatsu, T., Fukui, K., Nakagawa, N., Masui, R., Kuramitsu, S. (2010)
    J. Nucleic Acids 2010: 179594
  • Increased Rigidity of Domain Structures Enhances the Stability of a Mutant Enzyme Created by Directed Evolution
    Hoseki, J., Okamoto, A., Takada, N., Suenaga, A., Funatsugi, N., Konagaya, A., Taiji, M., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2003)
    Biochemistry 42, 14469-14475.
  • Disruption of Thermus thermophilus Genes by Homologous Recombination Using A Thermostable Kanamycin-Resistant Marker
    Hashimoto, Y., Yano, T., Kuramitsu, S. and Kagamiyama, H. (2001)
    FEBS Lett. 506, 231-234.
  • Directed Evolution of Thermostable Kanamycin-Resistant Gene Products in an Extremely Thermophilic Bacterium, Thermus thermophilus
    Hoseki, J., Yano, T., Koyama, Y., Kuramitsu, S. and Kagamiyama, H. (1999)
    J. Biochem. 126, 951-956.

Ordering information

in Japanese

Forms

Please specify ID (ex. TEx01A01, TDs01A01) of individual clone(s).

Please indicate Terms and Conditions for Distribution in MTA as follows:

In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, the USER is expected to cite the following literature.
(Yokoyama et al., 2000, Nature Struct. Biol. 7, 943-945).

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] 
Order Form for Bank Transfer Payment. [Word] 

Material Transfer Agreement (Category I MTA) [Word]

For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • Regarding Section 2(a):
    Please write your research purpose in detail. We need description specifically how and for what purpose you are going to use the DNA Bank resource(s). If the information is considered insufficient, we may ask you to add more or rewrite it.
    We can check whether the documents are filled out correctly or not in advance. Please email documents to us.
  • Regarding signature line:
    "Authorized Representative" is a person who is responsible for intellectual property rights. We request that the candidate is in one of the following positions, he/she can sign the MTA as the Authorized Representative. For anything unclear, please contact us by email.
    • College/University/Graduate School: President, Dean, Director or Head of Department
    • Research Institution: Director
    • Corporation: President, CEO, Director
    • Any officer appointed as Intellectual Property Administrator by the organization
    The MTA is a formal contract to be executed between institutions. Therefore, we ask your Authorized Representative to be an authority listed above.
Material Transfer Agreement (Category II MTA) [Word]

For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms to:
The DNA Bank, RIKEN BioResource Research Center (BRC),
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dna_sec.brc@riken.jp
FAX: (+81)-29-836-9120

Please visit further information of distribution and fees.

Distribution fee per clone (as of April 1st, 2023):
JPY 9,460 (For use in research for not-for-profit academic purpose).
JPY 18,920 (For use in research for-profit-research purpose).
  • The cost of shipping containers, dry ice (if required) and freight will be charged separately. These are not included in the fee.
  • For details for fee and payment, please visit Information of Request for Distribution.

TIPS

  • Strain Thermus thermophilus HB8 (JCM 10941T) of BRC-JCM
  • Genomic DNA (cat# JGD05989) of Thermus thermophilus HB8 (JCM 10941T)

go to Head


(GRP0051e 2012.10.22 T.M.)

2023.06.08



Comments are closed.