General Information
MSM/Ms Mouse BAC deposited by Dr. Kuniya Abe, RIKEN BRC; Mus musculus molossinus genomic DNA consists of 200,000 BAC clones. Individual clones are available.
Individual clone ID can be get on the Mouse BAC browser.
Instruction: Searching BAC clone by the BAC browser
Ordering information
Forms
Forms | Description |
---|---|
Form A | Order Form Please specify ID of clone(s) ex. MSMg01-045A01. Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express and others). |
Form C | Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution. Please indicate “NBRP MSM/Ms mouse BAC clone” as the BIOLOGICAL RESOURCE. Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Abe et al., 2004, Genome Res. 14: 2439-2447).” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format) |
![](https://dnaconda.riken.jp/images/arrow_down.png)
Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] |
Order Form for Bank Transfer Payment. [Word] |
Material Transfer Agreement (Category I MTA) [Word] For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
| Material Transfer Agreement (Category II MTA) [Word] For the use of our bioresource in research for the following cases:
|
![](https://dnaconda.riken.jp/images/arrow_down.png)
Send forms:
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Please visit further information of distribution and fees.
Distribution fee per clone (as of April 1st, 2023): JPY 9,460 (For use in research for not-for-profit academic purpose). JPY 18,920 (For use in research for-profit-research purpose).
|
Distribution information
- MSM/Ms mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
- When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
- When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
- The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
- Please refer BAC Related Information for further information.
Related Information
Data Sheet
MSM/Ms mouse BAC clone | |
Strain information | |
Species | Mus musculus molossinus |
Strain | MSM/Ms |
Group | Wild mouse-derived strains |
Mus musculus molossinus (M.MOL-MSM) | |
Year | 1978 |
Origin | Mishima, Shizuoka |
Generation | F56+9 |
Clone information | |
Vector | pBACe3.6 (Cmr, U80929), EcoRI site |
Insert | EcoRI partial digestion |
Host | DH10B, E. coli |
Sequence primers | 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC
3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG275743 to AG613213 |
Total number of clones (384-well plate) | version 1, ca. 110,000 clones (288 plates)
version 2, ca. 110,000 clones (288 plates) |
Average length and coverage | 125 kb, 10 times (ca. 90%) genome coverage |
Reference
- Reference of this BAC: Abe K, Noguchi H, Tagawa K, Yuzuriha M, Toyoda A, Kojima T, Ezawa K, Saitou N, Hattori M, Sakaki Y, Moriwaki K, Shiroishi T. (2004) Contribution of Asian mouse subspecies Mus musculus molossinus to genomic constitution of strain C57BL/6J, as defined by BAC-end sequence-SNP analysis. Genome Res. 14 (12): 2439-2447 (2004). PMID: 15574823
- MSM/Ms BAC Information site
- Articles Published by Using This Materials
- References and tips
- NIG_MoG2, the NIG Mouse Genome database
- Genome Browser Gateway, UCSC
- Please visit Informaion site
for articles published by using this materials, references and tips.
(GRP0039e 2004.06.14 T.M.)
2021.11.18