Japanese macaque BAC clone

Japanese macaque BAC clone

National Bioresource Project Macaque Monkeys
Macaque Monkey in www.nbrp.jpThe nucleotide sequencing was done by the National Institute for Physiological Sciences and the National Institute of Genetics under the MEXT NBRP Japanese Macaques Genome Information Upgrading Program.

Searching Clones

Please find ID of individual clone(s) using the databases, Japanese macaque BAC browser.
Searching BAC clone by the BAC browser (by the National Institute of Genetics)

Order Forms

Please complete following forms:

  • Material Transfer Agreement, FormC (pdf)
    • Put “NBRP Japanese macaque BAC clone MSB2” as the name of resource.
    • Put the following terms and conditions for distribution in the section 4:
    • In publishing the research results obtained by use of the NBRP Japanese macaque BAC clone, the USER must state an acknowledgement to the National BioResource Project (NBRP), Japan.
  • Order Form, FormA (MS-Word or pdf)
    • Put Id of indivisual clone(s) ex. MSB2-456A01 in this form.

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Fom for Credit Card Payment. (Visa or Master Card only) [Word] 
Order Form for Bank Transfer Payment. [Word] 

Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

  • We ask a signature of the Authorized Representative of a recipient institution.
    In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.
  • Please ask us if applicable for the following use:
    • For research to be conducted by for-profit organizations.
    • For collaborative research between for-profit organization and not-for-profit organization.
    • For research by not-for- organization outsourced and sponsored by for-profit organization.
    • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Remarks:
Japanese macaque is one of the animals as the object of Convention on International Trade in Endangered Species (CITES). Therefore, according to the CITES the permissions of the regulatory bodies are necessary in both exporting and importing countries.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Further information for sale.

Shipment

NBRP Japanese macaque BAC clone(s) is shipped as stab agar culture with 50 ug/ml Amp. in an individual tube.

Related Information

go to Head

Data Sheet

Japanese macaque BAC clone MSB2 information
Species Macaca fuscata fuscata (Japanese macaque)
Sex male
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG613379-AG780537
Total number of clones (384-well plate) MSB2, ca. 200,000 clones (521 plates)
Average length 120 kb

(2013.04.13 T.M.)

2019.02.02



Comments are closed.