Japanese macaque BAC clone
National Bioresource Project Macaque Monkeys Macaque Monkey in www.nbrp.jpThe nucleotide sequencing was done by the National Institute for Physiological Sciences and the National Institute of Genetics under the MEXT NBRP Japanese Macaques Genome Information Upgrading Program. |
Searching Clones
Please find ID of individual clone(s) using the databases, Japanese macaque BAC browser.
Searching BAC clone by the BAC browser (by the National Institute of Genetics)
Order Forms
Please complete following forms:
- Material Transfer Agreement, FormC (pdf)
- Put “NBRP Japanese macaque BAC clone MSB2” as the name of resource.
- Put the following terms and conditions for distribution in the section 4:
- In publishing the research results obtained by use of the NBRP Japanese macaque BAC clone, the USER must state an acknowledgement to the National BioResource Project (NBRP), Japan.
- Order Form, FormA (MS-Word or pdf)
- Put Id of indivisual clone(s) ex. MSB2-456A01 in this form.
Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] |
Order Form for Bank Transfer Payment. [Word] |
Material Transfer Agreement (Category I MTA) [Word] For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
|
Remarks:
Japanese macaque is one of the animals as the object of Convention on International Trade in Endangered Species (CITES). Therefore, according to the CITES the permissions of the regulatory bodies are necessary in both exporting and importing countries.
Send forms:
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Shipment
NBRP Japanese macaque BAC clone(s) is shipped as stab agar culture with 50 ug/ml Amp. in an individual tube.
Related Information
- Isa, T., Yamane, I., Hamai, M., Inagaki, H. (2009) Japanese macaques as laboratory animals. Exp. Anim., 58 (5): 451-457. PMID: 19897928
- National Bioresource Project Macaque Monkeys
- BLAST searching in National BioResource Project
- Release of WGS data of Japanese macaque (Macaca fuscata fuscata) (2018.04.11)
- Rhesus Macaque BAC and Fosmid Mappings onto the Rhesus Genome
(by the Bioinformatics Research Lab at Baylor College of Medicine) - UCSC Rhesus (Macaca mulatta) Genome Browser Gateway
Data Sheet
Japanese macaque BAC clone MSB2 information | |
Species | Macaca fuscata fuscata (Japanese macaque) |
Sex | male |
Clone information | |
Vector | pKS145 (SacI site, Ampr, AB013921) [pdf] |
Insert | SacI partial digestion |
Host | DH10B, E. coli |
Sequencing Primer | AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921. |
Nucleotide sequences | DNA Databank of Japan (DDBJ), AG613379-AG780537 |
Total number of clones (384-well plate) | MSB2, ca. 200,000 clones (521 plates) |
Average length | 120 kb |
(2013.04.13 T.M.)
2023.06.08