Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Japanese macaque BAC clone


Japanese macaque BAC clone

National Bioresource Project Macaque Monkeys
Macaque Monkey in www.nbrp.jpThe nucleotide sequencing was done by the National Institute for Physiological Sciences and the National Institute of Genetics under the MEXT NBRP Japanese Macaques Genome Information Upgrading Program.

Searching Clones

Please find ID of individual clone(s) using the databases, Japanese macaque BAC browser.
Searching BAC clone by the BAC browser (by the National Institute of Genetics)

Order Forms

Please complete following forms:

  • Material Transfer Agreement, FormC (pdf)
    • Put “NBRP Japanese macaque BAC clone MSB2” as the name of resource.
    • Put the following terms and conditions for distribution in the section 4:
    • In publishing the research results obtained by use of the NBRP Japanese macaque BAC clone, the USER must state an acknowledgement to the National BioResource Project (NBRP), Japan.
  • Order Form, FormA (MS-Word or pdf)
    • Put Id of indivisual clone(s) ex. MSB2-456A01 in this form.

Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
For Credit Card Payment. (Visa or Master Card only)
Order Form (Credit Card Payment) 
For bank transfer or check payment.
Order Form (Bank Transfer or Check Payment) 

Material Transfer Agreement (Category I MTA) [Word]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

  • We ask a signature of the Authorized Representative of a recipient institution.
    In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.
  • Please ask us if applicable for the following use:
    • For research to be conducted by for-profit organizations.
    • For collaborative research between for-profit organization and not-for-profit organization.
    • For research by not-for- organization outsourced and sponsored by for-profit organization.
    • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Remarks:
Japanese macaque is one of the animals as the object of Convention on International Trade in Endangered Species (CITES). Therefore, according to the CITES the permissions of the regulatory bodies are necessary in both exporting and importing countries.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dnabank.brc@riken.jp
FAX: (+81)-29-836-9120

Further information for sale.

Shipment

NBRP Japanese macaque BAC clone(s) is shipped as stab agar culture with 50 ug/ml Amp. in an individual tube.

Related Information

go to Head

Data Sheet

Japanese macaque BAC clone MSB2 information
Species Macaca fuscata fuscata (Japanese macaque)
Sex male
Clone information
Vector pKS145 (SacI site, Ampr, AB013921) [pdf]
Insert SacI partial digestion
Host DH10B, E. coli
Sequencing Primer AFF, 5′- TTCCCAGTCACGACGTTGTA -3′, 5′ primer, 106 to 87 of AB013921. AFR, 5′- GGAATTGTGAGCGGATAACAA -3′, 3′ primer, 7466 to 7486 of AB013921.
Nucleotide sequences DNA Databank of Japan (DDBJ), AG613379-AG780537
Total number of clones (384-well plate) MSB2, ca. 200,000 clones (521 plates)
Average length 120 kb

(2013.04.13 T.M.)

2019.02.02