Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Sequencing and PCR primers


Sequencing & PCR primers

Please contact DNA Bank dnabank.brc@riken.jp for any commnets. Thank you.

Name of Primer Sequence Vector Purpose
T7long 5′-CGCCAAGCTCTAATACGACTCACTATAGGG-3′ T7 promoter sequence containing vectors
T7 5′-TAATACGACTCACTATAGGG -3′ pCMV_S-FLAG (RDB 5956) Sequencing 5′ of inserted DNA
SP6 5′-ATTTAGGTGACACTATAG -3′ pCMV_S-FLAG (RDB 5956) Sequencing 3′ of inserted DNA
pAxCAF1 5′-GGCTTCTGGCGTGTGACCGGC-3′ CAG promoter containing vectors Sequencing 5′ of inserted DNA
pAxCAR1 5′-CAGAGGGAAAAAGATCTCAGTGG-3′ CAG promoter containing vectors Sequencing 3′ of inserted DNA
pAxCALNLF1 5′-CACTGCATTCTAGTTGTGGTTTGTCC-3′ LNL (loxP) containing vectors Sequencing 5′ of inserted DNA
M13 5′-GTTTTCCCAGTCACGACGTTGTA-3′ pKM2L luciferase vector Sequencing 5′ of inserted DNA
phRLR2 5′-CCAATAGGTGCCTATCAGAAACGC-3′ pKM2L luciferase vector Sequencing 3′ of inserted DNA
7723km F 5′-AATTTCTGGAATGGGGTTCA-3′ Tth Disruption Plasmid Km toward insert
7723km R 5′-GATTGCGATGCTGATTCGT-3′ Tth Disruption Plasmid Km toward insert
BGHrev 5′- TAGAAGGCACAGTCGAGG -3′ BGHpA containing vector Sequencing 3′ of inserted DNA
pOTB7_F(7-32) 5′- AACGCGGCTACAATTAATACATAACC -3′ pOTB7 Sequencing 5′ of inserted DNA
pOTB7_R(358-335) 5′- GTACTGCAGCCGATTCATTAATGC -3′ pOTB7 Sequencing 3′ of inserted DNA
pUAST3′ 5′- AACCAAGTAAATCAACTGC -3′ pUAST Sequencing 5′ of inserted DNA
SV40-3’UTR 5′- ATCTCTGTAGGTAGTTTGTC -3′ pUAST Sequencing 3′ of inserted DNA
ME-720Fw 5′- CCGGATCCGGTGGTGCAAATC -3′ pME18S Sequencing 5′ of inserted DNA
ME-735Fw 5′- GGATGTTGCCTTTACTTCTA -3′ pME18S Sequencing 5′ of inserted DNA
ME-1290Rv 5′- ATAAGCTGCAATAAACAAGTTAACAAC -3′ pME18S Sequencing 3′ of inserted DNA
ME-1250Rv 5′- TGTGGGAGGTTTTTTCTCTA -3′ pME18S Sequencing 3′ of inserted DNA
pGCAP_F 5′- CTCAGTGGATGTTGCCTTTAC -3′ pGCAP1, pGCAP10 Sequencing 5′ of inserted DNA
pGCAP_R 5′- GCATTCTAGTTGTGGTTTGTCC -3′ pGCAP1, pGCAP10 Sequencing 3′ of inserted DNA
pMFG_F 5′- CTTCTCTAGGCGCCCATATG -3′ pMFG Sequencing 5′ of inserted DNA
pMFG_R 5′- GCCTGGACCACTGATATCCT -3′ pMFG Sequencing 3′ of inserted DNA

Related Information

PCR Primers for Detection of Adenovirus Vector
List of STS Markers for Detection of Virus Genes

go to Head


(2011.01.12 T.M.)

2018.04.28