Clone Search

Resources for

Clones & Vectors for Gene Expression
  in E. coli
  in T. thermophilus HB8
  in S. pombe
  in S. cerevisiae
  in Mammalian Cells

Research Tools
  Genome Editing
  Fluorescent Proteins
  Luminescent Proteins
  Sensor & Visualization
  Plant gene resources

Clone Set, Library & Genomic DNA
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Genomic DNA

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vectors

Gene Set Collection
  Autophagy
  Circadian Clock
  Notch Signaling
  Sphingolipid Signaling

Search and Browse
  Key word search
  Browsing by category
  Browsing by species
  Depositors List

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

BRC News

Sequencing and PCR primers


Sequencing & PCR primers

Please contact DNA Bank dnabank.brc@riken.jp for any commnets. Thank you.

Primer ID Primer name Sequence(5′-3′)
Pr0193 11E1(TTHB149)F-kan 5′ GCGATGATGAAGTACGTGGA 3′
Pr0194 11E1(TTHB149)R-kan 5′ AAAGCTCCTCCAAAGCTTCC 3′
Pr0001 3’pFB(pFB-3′) 5′ CGAACCCCAGAGTCCCGCTCA 3′
Pr0618 5_junc_F1 5′ GAGCCTCTGCTAACCATGTT 3′
Pr0619 5_junc_F2 5′ GCAACGTGCTGGTTATTGTGC 3′
Pr0002 5’Retro(pFB-5′) 5′ GGCTGCCGACCCCGGGGGTGG 3′
Pr0562 7723km_F 5′ AATTTCTGGAATGGGGTTCA 3′
Pr0563 7723km_R 5′ GATTGCGATGCTGATTCGT 3′
Pr0624 Ad5_pacF 5′ GGAAGTGACAATTTTCGCGC 3′
Pr0450 ADH1pro_F 5′ AGTTTGCTGTCTTGCTATCAAG 3′
Pr0162 ADH-Forward 5′ GTCAGGTTGCTTTCTCAGGTATAG 3′
Pr0003 ADHpro_C 5′ GCTATACCAAGCATACAATC 3′
Pr0048 ADHrev 5′ CTATACCTGAGAAAGCAACCTGAC 3′
Pr0323 AFF 5′ TTCCCAGTCACGACGTTGTA 3′
Pr0324 AFR 5′ GGAATTGTGAGCGGATAACAA 3′
Pr0405 Ago2 1468-1487 5′ AGATCTCGAGAGACGCCGGC 3′
Pr0401 Ago2 1521-1540 5′ CCTGAAGAACACGTATGCGG 3′
Pr0540 Akaluc 1215-1243 5′ AACGCTCTCATCGACAAGG 3′
Pr0539 Akaluc 576-593 5′ CGCCCTGATCATGAACAGT 3′
Pr0271 Amp_C_F 5′ TCTCGCGGTATCATTGCAGCAC 3′
Pr0008 Amp_R 5′ GCGACACGGAAATGTTGAATA 3′
Pr0189 AOX1pro 5′ ACTGGTTCCAATTGACAAGC 3′
Pr0190 AOX1term 5′ GTATCAAAAATGAAGCCTGC 3′
Pr0654 araBADpro_F1 5′ ACACTTTGCTATGCCATAGC 3′
Pr0692 argH.ext.F 5′ AAACCCTGTTGGCATGGGCGAAG 3′
Pr0693 argH.ext.R 5′ GCTGGTCCGCTCCAGCAACATCAC 3′
Pr0163 ars_R1 5′ GCTACCATTCACTTAACTTCCTGAT 3′
Pr0694 asnA.ext.F 5′ TGAACGCGTTGGGATCTACCTGTG 3′
Pr0695 asnA.ext.R 5′ ACGGTTCCTGAGCAGGTTGATGGTC 3′
Pr0696 asnB.ext.F 5′ TCGAACCTGTGACCCCATCATTATGAG 3′
Pr0697 asnB.ext.R 5′ ACACCCACGGGCGCGGTTTTTATC 3′
Pr0716 aspC internal F 5′ CACTTGTTCTTTTGTCAGGCCACTG 3′
Pr0717 aspC internal R 5′ GGCTGAACAGTATCTGCTCGAAAATG 3′
Pr0686 aspC.ext.F 5′ TTGATGACAGCGGCCTGACACTGATGCAG 3′
Pr0687 aspC.ext.R 5′ ACTCCAACTTCTTTGGTCTGGTTGATGG 3′
Pr0411 attB2-R1 5′ CACTTTGTACAAGAAAGCTG 3′
Pr0620 Avgfp-M_F1 5′ CCCGAAGGTTATGTACAGGA 3′
Pr0621 Avgfp-M_F2 5′ GACGGGAACTACAAGACACG 3′
Pr0622 Avgfp-M_R 5′ CGTGTCTTGTAGTTCCCGTC 3′
Pr0680 avtA.extF 5′ ATACCCGCCTGTTCCGTGAAG 3′
Pr0681 avtA.extR 5′ TCGGTTGCCGTACCTGTGAAG 3′
Pr0347 AxIT_R 5′ TCCACAAAAAACACCCAGAA 3′
Pr0355 B95.delta_fabR#1 5′ TGGAGCAATCCAGTATGTTCATTCTC 3′
Pr0356 B95.delta_fabR#2 5′ AAGTACCATTAATCGATAAGCCAGC 3′
Pr0359 B95.delta_fabR#3 5′ CCAAAGGCGGGAGTGTGA 3′
Pr0360 B95.delta_fabR#4 5′ CCAAAGGCGGGAGTGTGT 3′
Pr0361 B95.delta_fabR#5 5′ GAGACCGAGGTGCGGAT 3′
Pr0362 B95.delta_fabR#6 5′ GAGACCGAGGTGCGGAC 3′
Pr0353 B95.delta_prfA#1 5′ AGCAAGTTCGCGATGAGTTAACC 3′
Pr0354 B95.delta_prfA#2 5′ ACCCCGGTTAAATGAGCAATGG 3′
Pr0291 BAXF1 5′ ATGGACGGGTCCGGGGAGCAGC 3′
Pr0292 BAXR1 5′ TCAGCCCATCTTCTTCCAGATGGTG 3′
Pr0497 beta-gi_F 5′ ACTCTGAGTCCAAACCGGGC 3′
Pr0512 beta-gro_rev 5′ GTCCATGGTGATACAAGGGA 3′
Pr0385 BGH_F2 5′ CTGTGCCTTCTAGTTGCCAG 3′
Pr0009 BGH_rev 5′ TAGAAGGCACAGTCGAGG 3′
Pr0606 BGH_rev2 5′ TATTAGGAAAGGACAGTGGG 3′
Pr0746 bGH-B_R 5′ GAGGGGCAAACAACAGATGGCT 3′
Pr0747 bGH-M_R 5′ TTAGGAAAGGACAGTGGGAG 3′
Pr0373 BGHpA_F 5′ AAATGAGGAAATTGCATCGC 3′
Pr0010 BKreverse 5′ ACAGGAAACAGCTATGACCTTG 3′
Pr0564 Bkvirus_F1 5′ GGGATTCAGTGCTTGATCCATG 3′
Pr0565 Bkvirus_F2 5′ CAGGACTCCCACTCTTCTGTTCC 3′
Pr0566 Bkvirus_R1 5′ CCCCAGCAGCAATTTCAGCCA 3′
Pr0458 BPV-1_F 5′ TCTTTGCAATCTACTTAGGAGGG 3′
Pr0758 BSD_R1 5′ CAGCACCACGAGTTCTGCAC 3′
Pr0381 CAG gfp_F 5′ GCGGCATGAGTAAAGGAGAA 3′
Pr0589 CAG_F1 5′ AATTATTTTGTGCAGCGATG 3′
Pr0590 CAG_F2 5′ ATTACCATGGTCGAGGTGAG 3′
Pr0591 CAG_F3 5′ TTTCTTTTCTGTGGCTGCGTG 3′
Pr0584 CAG_R1 5′ TTGTCCCAAATCTGTGCGGA 3′
Pr0585 CAG_R2 5′ TATAAAAAGCGAAGCGCGCG 3′
Pr0586 CAG_R3 5′ TCCGCACAGATTTGGGACAA 3′
Pr0587 CAG_R4 5′ CGCGCGCTTCGCTTTTTATA 3′
Pr0593 CAG_R5 5′ CACGCAGCCACAGAAAAGAAAC 3′
Pr0616 CAGen_R1 5′ CCCTATTGGCGTTACTATGG 3′
Pr0052 CaMKIIpro_F 5′ CTCGTCAGTCAAGCCGGTTCTC 3′
Pr0558 Cas9-C_F 5′ ACGAGACACGGATCGACCTG 3′
Pr0650 Cas9-N_R1 5′ TGATGCTGTGCCGGTCGGTG 3′
Pr0754 Cas9-N_R3 5′ TGCTGGGCACCTTGTACTCG 3′
Pr0136 ccdB-C_F 5′ TCTGCTGTCAGATAAAGTC 3′
Pr0756 ccg1-B_R 5′ CCATCTTCAGATTCTGCCTG 3′
Pr0017 C-CMV-24 5′ ACAAGGCTGGTGGGCACTGGAGTG 3′
Pr0237 CD80_683F 5′ TAATAACCTCTCCATTGTG 3′
Pr0281 Cdx2ER-M_F 5′ AGGACAAAAGACAAATACCGGG 3′
Pr0444 chimeric intron 3-prime 5′ TACTGACATCCACTTTGCCT 3′
Pr0159 CiEF1pro_F 5′ AGCAAATTTCTGTGCATTCG 3′
Pr0011 C-LTR-R 5′ ATCTGTTCTTGGCCCTGAG 3′
Pr0476 Cm_C_F 5′ CAGTACTGCGATGAGTGGC 3′
Pr0012 Cm_M_R 5′ CGTTTCAGTTTGCTCATGG 3′
Pr0013 Cm_N_F 5′ GTTCAGCTGGATATTACGG 3′
Pr0014 Cm_N_rev 5′ TGGTTATAGGTACATTGAGC 3′
Pr0015 CMK1ter_R 5′ GATCGCTATCAGAACTACAG 3′
Pr0643 cmlc2pro_F 5′ AGGGGACGAACAGAAACACTGC 3′
Pr0644 cmlc2pro_R 5′ ATCGGTTCTCTGTATTTGAC 3′
Pr0733 cmr6h_up_F 5′ GCAACCCCCAGGAGCTGAAG 3′
Pr0652 CMV enh_F1 5′ GTACGCCCCCTATTGACGTC 3′
Pr0149 CMV*F 5′ TGATATACACTGTTTGAGATGAGG 3′
Pr0173 CMV_en_R 5′ GGAACTCCATATATGGG 3′
Pr0016 CMV_Forward 5′ GCACCAAAATCAACGGGACTT 3′
Pr0018 CMV24ver2 5′ ACAAAATGATGCAACTTAAT 3′
Pr0553 CMVd3_R 5′ GCTCTGCTTATATAGACCTCC 3′
Pr0393 ColE1ori_F 5′ AGCTTCCAGGGGGAAACGCCTG 3′
Pr0259 COPIApro-F 5′ TGAATGGCCACACCTTTTATGCC 3′
Pr0725 cPPT/CTS-E_R 5′ GCTGTCCCTGTAATAAACCCG 3′
Pr0161 cPPT+CTS_F 5′ TTTTCGGGTTTATTACAGGG 3′
Pr0303 cPPT+CTS_v2_F 5′ AGTGCAGGGGAAAGAATAG 3′
Pr0427 Cre-C 5′ GAACTATATCCGTAACCTGG 3′
Pr0327 Cre-N_R 5′ ACGACCGGCAAACGGACAGAAG 3′
Pr0255 CSII_CMV5_v2 5′ AGCAGAGCTCGTTTAGTGAACCG 3′
Pr0020 CSII-CMV3′ 5′ GGCTTCGGCCAGTAACGTTAGG 3′
Pr0021 CSII-CMV5′ 5′ AGCAGAGCTGGTTTAGTGAACCG 3′
Pr0608 CTNNB1_F2 5′ AACTTGCCACACGTGCAATC 3′
Pr0609 CTNNB1_R2 5′ CTCCAGACTTAAAGATGGCC 3′
Pr0273 CYC1ter_F 5′ TGTACGCATGTAACATTATACTG 3′
Pr0022 CYC1ter_R 5′ AATAGGGACCTAGACTTCAG 3′
Pr0023 CYK3_R 5′ CCTACAGCATAATGAATACC 3′
Pr0676 cysE.extF 5′ GAAATTACGCAAGATTCGCTGGTGC 3′
Pr0677 cysE.extR 5′ CGAGGCGTTAGGCGATCAAATTCC 3′
Pr0357 D03160F1 5′ TGGGCGGTAGGCGTGTACGGT 3′
Pr0358 D03160R1 5′ TAAGTTATGTAACGGAGCTTT 3′
Pr0408 dCAS9#1 5′ AGAAGCTGTACCTGTACTACC 3′
Pr0072 DUAL-R 5′ ATCCAAGCACTAGTCATGAC 3′
Pr0117 Dyrk1a_F1 5′ CTCTCTGTGGACTTGATCAA 3′
Pr0118 Dyrk1a_F2 5′ TAACCCCAAACGGAGTGCAAT 3′
Pr0119 Dyrk1a_R1 5′ GAGCTATTTGTTGGAGAATT 3′
Pr0640 E4ORF6/7R1 5′ GGTGGCAGGTTGAATACTAGGG 3′
Pr0634 E4ORF6_7F1 5′ ATGTAGGCGTGGACTTCTCC 3′
Pr0760 EBNA1-C_F 5′ AACTCATATATTTGCTGAGG 3′
Pr0251 ECM1-M_F 5′ ACCTGCCCAACTCCCTGCTG 3′
Pr0205 EF1a_F2 5′ AATCGGACGGGGGTAGTCTC 3′
Pr0740 EF1a_F3 5′ GCCTCAGACAGTGGTTCAAAG 3′
Pr0168 EF1a-C_F 5′ AGTTAGGCCAGCTTGGCACTTGATG 3′
Pr0489 EF1a-C_F2 5′ AATCCCCGCCCAGTAGAGGC 3′
Pr0223 EF1a-M_F 5′ TTCGAGGCCTTGCGCTTAAG 3′
Pr0024 EF1a-N_R 5′ TAGGCACCGGTTCAATTG 3′
Pr0490 EF1a-N_R2 5′ TGATAGTGGACCTTAAGCCG 3′
Pr0179 EF1a-pA_R 5′ ATCATTAACCAGTCTTTTACTAC 3′
Pr0025 EGFP-C 5′ CATGGTCCTGCTGGAGTTCGTG 3′
Pr0402 EGFP-C2 5′ ACTACCTGAGCACCCAGTCC 3′
Pr0026 EGFP-C-rev 5′ CACGAACTCCAGCAGGACCATG 3′
Pr0743 EGFP-M_R 5′ TGTTCTGCTGGTAGTGGTCG 3′
Pr0027 EGFP-N 5′ CGTCGCCGTCCAGCTCGACCAG 3′
Pr0649 EGFP-N_F 5′ TCGAGCTGGACGGCGACGTAAA 3′
Pr0156 EGFP-N_rev 5′ CCATCCTGGTCGAGCTGGACG 3′
Pr0313 EGFR-F5 5′ CAGGTCTTGAAGGCTGTC 3′
Pr0420 eIF4A1 inner F1 5′ ACCCACTCGAGAATTGGCTCA 3′
Pr0258 env_F 5′ AAGGAATAGAAGAAGAAGGTGG 3′
Pr0176 EphB2_F2 5′ TACCAGACAAGCATCCAGG 3′
Pr0576 ESFR-N_rev1 5′ AAAGGAATTCGCTCCACTGTG 3′
Pr0426 eSpCas9(1.1) 5′ CAGGAACTGGACATCAACCG 3′
Pr0412 EYFP-C_F 5′ ACAACCACTACCTGAGCTAC 3′
Pr0633 F1BERF2 5′ ATGAAGCGCGCAAGACCGTC 3′
Pr0280 f1ori_F 5′ AGAAAGGAAGGGAAGAAAGC 3′
Pr0308 f1ori_F2 5′ ACAACACTCAACCCTATCTCGG 3′
Pr0028 F1ori_R 5′ CGTTTACCGCTACTGCG 3′
Pr0029 F1ori_R2 5′ CGCAGTAGCGGTAAACG 3′
Pr0142 f1ori_R3 5′ TTAATGCGCCGCTACAGGGC 3′
Pr0437 f1oriF3 5′ ATTAGGGTGATGGTTCACGTA 3′
Pr0233 FBXO21-01.gnu 5′ AATTGACAGCATCGTGGAGC 3′
Pr0234 FBXO21-02.gnu 5′ TCGACCAGTCATACCAGCTC 3′
Pr0639 fiber-B_F 5′ GGAGACACAACTCCAAGTGC 3′
Pr0636 fiber-M_F1 5′ TAACCTAAGCACTGCCAAGG 3′
Pr0638 fiber-M_F2 5′ CCTTCCTGGACCCAGAATAT 3′
Pr0637 fiber-M_R 5′ CCAAATTCAAGCCCATCTCC 3′
Pr0511 FIP1L1_F 5′ ATCGATATGGGAGGGCCGAA 3′
Pr0515 FIP1L1v3_F2 5′ GGGGCAATTGATGTTATCGG 3′
Pr0730 gag_t-C_F 5′ TCTCTCCCCCTTGAACCTCC 3′
Pr0471 gag-M_F 5′ ACCTGGGAAGCCTTGGCTTTTG 3′
Pr0745 gag-N_R 5′ ACATCTTTCCAGTGACCTAAG 3′
Pr0030 GAL1pro_F 5′ TTTTCGGTTTGTATTACTTC 3′
Pr0279 GAL1pro_R 5′ TGAAGACGAGGACGCACG 3′
Pr0653 GAL4DNA-BD_F1 5′ TCAGTGGAGACTGATATGCC 3′
Pr0484 Gata4-C_F 5′ AGTGCTGTCTGCTCTGAAGCTG 3′
Pr0598 GEX5_R1 5′ CCATGAGGTGGATGTGATACAG 3′
Pr0599 GEX5_R2 5′ CAAGGTCATCAGGGTGAGGA 3′
Pr0421 gfp_mf 5′ CACTGGAGTTGTCCCAATTC 3′
Pr0304 GFP-C 5′ ACTCCAATTGGCGATGGCCCTG 3′
Pr0466 GFP-N_R 5′ TTGTGCCCATTAACATCACC 3′
Pr0198 GL2 5′ CTTTATGTTTTTGGCGTCTTCCA 3′
Pr0005 GLIS1 innerF1 5′ ACTTGAAGCCTGCCGGAAGG 3′
Pr0706 glnA.ext.F 5′ TCAGGTAACGCTTTGCTGAGCAGCTG 3′
Pr0707 glnA.ext.R 5′ CAACAATCGGCTTCAGGCCGTAAGC 3′
Pr0684 glyA.extF 5′ TGATTACGGCATTGGCTCGTC 3′
Pr0685 glyA.extR 5′ TAGATTTCCGCCTCGCGATTG 3′
Pr0177 Gmip-M_R 5′ TGGAATCCAAGGCTATGGTCAGGGG 3′
Pr0763 GNP Primer #10 5′ TTTTTTTTTTTTTTTTTTTTCTT 3′
Pr0153 GST-M_F 5′ ATATTAGATACGGTGTTTCG 3′
Pr0448 GST-N_rev 5′ TCATCGCGCTCATACAAATG 3′
Pr0374 H1pro_F 5′ AGTGGCGCCCTGCAATATTTGC 3′
Pr0472 Halo-C_F 5′ AACTGCAAGGCTGTGGACATCG 3′
Pr0492 HaloTag-N_R 5′ ATCGACGTAGTGCATGC 3′
Pr0322 hBIG1_F1 5′ AAGAACAAGGGATGCTTGGC 3′
Pr0597 hBIG1_F2 5′ GGACCAACATGACTTTTCAGG 3′
Pr0344 hBIG2_F1 5′ TGAACACGGCATCGAGCTG 3′
Pr0425 hCAS9+2010_F 5′ GATCAATGGGATCCGAGAC 3′
Pr0424 hCAS9+3550_R 5′ ATCCTTTCGCCTCGAGAAAG 3′
Pr0242 HCMVIEE_F2 5′ TAGTAATCAATTACGGGGTCA 3′
Pr0174 hCTNNB1_M_F 5′ ATCATACTGGCTAGTGGTGG 3′
Pr0175 hCTNNB1_M_R 5′ ACCAGCTTCTACAATAGCC 3′
Pr0463 hFAS-M_F 5′ AGGACATGGCTTAGAAGTGG 3′
Pr0464 hFAS-M_R 5′ ATGTTCACATTTGGTGCAAGGG 3′
Pr0245 hFLPe_R1 5′ TTCTTGATGTCGCTGAACCTGC 3′
Pr0248 hFLPe_R2 5′ AACTCATCCAGGTACACCAGTG 3′
Pr0172 hFLPe-C_F 5′ ATTGAGGAGTGGCAGCACATTG 3′
Pr0031 hGCSF_R 5′ TATTAAACAGGGATTTCTTG 3′
Pr0755 hGCSF_R2 5′ AGGGGCCGCTGTGCAGTCGG 3′
Pr0350 hGHpolyA-R 5′ AGGTTGTCTTCCCAACTTGC 3′
Pr0533 hGRalpha-M_F 5′ ACTCGAATGAGGACTGCAAG 3′
Pr0534 hGRalpha-N_R 5′ TTGCTTACTGAGCCTTTTTGG 3′
Pr0671 hHMOX1_R1 5′ CACATAAAGCAGGATGCCAG 3′
Pr0672 hHMOX1_R2 5′ AAACTGCTTCCCTGCTGGAA 3′
Pr0150 hICK-M_F 5′ AGTGCAATGAACTTCCGTTGG 3′
Pr0032 HIS3pro_F 5′ CTTTTTTTTTCTTAGCGATTGGC 3′
Pr0714 hisG internal F 5′ GACAGACAACTCTCGTTTACGCATAGC 3′
Pr0715 hisG internal R 5′ GTTTTTCCATCGTTTCCCAGAACAG 3′
Pr0690 hisG.ext.F 5′ TTACTCCCGGTAACTTGCCAGCCTC 3′
Pr0691 hisG.ext.R 5′ ATCAGAAGCCACGAAATCCGGCGTAG 3′
Pr0673 HIV-B_R 5′ TTAATACTGACGCTCTCGCACC 3′
Pr0131 HIVgp_F1 5′ ATCTAGCTTTGCAGGATTCG 3′
Pr0132 HIVgp_R1 5′ TGCTTCCTGCTGCTCCCAAG 3′
Pr0157 hKO_F 5′ AAGAAGATCCTGAAGATGCC 3′
Pr0167 hKO_N_R 5′ TGAACTCGTGGCCGTTCACGCTG 3′
Pr0034 HLA-DLA1200R 5′ ATTGTGTTCAGAAAAATCAC 3′
Pr0033 HLA-DLA700F 5′ GAAAACTGTCTCTGACACTC 3′
Pr0295 hMDM2F1 5′ ATGTGCAATACCAACATGTCTGTAC 3′
Pr0296 hMDM2R1 5′ CTAGGGGAAATAAGTTAGCACAATCATTTG 3′
Pr0260 hmKO_N 5′ ATTGTGACGCGCAGTGTCATC 3′
Pr0263 hmKO-N_R 5′ TCGATTGTGAACTCATGCC 3′
Pr0314 HMOX1-M_F 5′ AGCTCTTTGAGGAGTTGCAGG 3′
Pr0315 HMOX1-M_R 5′ ACGGGGGCAGAATCTTGCAC 3′
Pr0316 HMOX2-M_F 5′ TTCAAGCAGCTCTACCGGGC 3′
Pr0317 HMOX2-M_R 5′ AGTTCATTGAATATCTGCATG 3′
Pr0318 HMOX2-M_R2 5′ ATCCTCCAAGGTCTCTCTGGC 3′
Pr0319 HMOX2-N_R 5′ AGCTCCGAGAGGTCAGCCATTC 3′
Pr0075 hOCT4.F2 5′ TGTAACCGGCGCCAGAAGGG 3′
Pr0588 hPGKpro_R 5′ TCTCGAGGTGATAATTCCAC 3′
Pr0752 hRFWD3-C_R 5′ GTTGCCATCATTCTCTGGGC 3′
Pr0753 hRFWD3-N_F 5′ CAGCCTGACTTGCCAGCTAC 3′
Pr0757 hRFWD3-N_R 5′ AGACAGTTGCGGAGCAGG 3′
Pr0761 hRFWD3-N_R2 5′ TCCCAAGACCTCCACTTCTG 3′
Pr0567 hRluc_N_rev 5′ TGCTTCTCGGAATCATAGTAGTTG 3′
Pr0749 hRPL23-C_R 5′ CCTTTCATCTCGCCTTTATTG 3′
Pr0551 hsFLI1_F2 5′ aggggcacaaacgatcagta 3′
Pr0080 hSOX2.F3 5′ TCCGGGACATGATCAGCATGTA 3′
Pr0082 hSOX2_R2 5′ CTTGACGCGGTCCGGGCTGTT 3′
Pr0498 hsp70 promoter-rev 5′ AGCTGCGCTTGTTTATTTGC 3′
Pr0137 HSV_TK_pA_R 5′ TTTATTCTGTCTTTTTATTGC 3′
Pr0736 HSVTKup_f 5′ TATTGGTCCCAATGGGGTCT 3′
Pr0338 hTAZ-N_R 5′ AGCTAGGCTTCGGATTCATG 3′
Pr0215 hTICAM1-C_F 5′ ACGCAGCCTACTCAGCCTAC 3′
Pr0214 hTICAM1-N_R 5′ TTTCGGGCCTCATCCTGAAG 3′
Pr0207 hTICAM2-C_F 5′ CCAAACCATCAATGCCTTAGAG 3′
Pr0206 hTICAM2-N_R 5′ CATCTTGTAGCAGATTCTGGAC 3′
Pr0538 HTK-M_F 5′ AATGGACAACCGGTGAGTGG 3′
Pr0537 HTK-M_R 5′ AGGATGGTAGAAATGTTGTCGG 3′
Pr0592 HTK-M_R2 5′ TTAAGACCGAAGCGCTCGTC 3′
Pr0493 hTPP1-M_F 5′ ACCCACAGTGTCCGATGC 3′
Pr0742 hTTP-M_R 5′ AAGCACAGGAGGGTGGCCCG 3′
Pr0501 HygR-C_F 5′ ATAACAGCGGTCATTGACTG 3′
Pr0744 HygR-C_F2 5′ CCGGCCATTAGCCATATTATTC 3′
Pr0682 ilvE.extF 5′ CCAACGGTTAGGGATGGTTCG 3′
Pr0683 ilvE.extR 5′ GATCATCGCATCAACCAGATCG 3′
Pr0216 IRAK011L20_1038 5′ AGTGAATACATGGTAGCAGGGTCTTTG 3′
Pr0197 IRAK011L20_515 5′ TTGTGGAGAAGCAGAGGGACTCAGTG 3′
Pr0573 IRES_R3 5′ ACACCGGCCTTATTCCAAG 3′
Pr0036 IRES-F 5′ TTGTATGGGATCTGATCTGG 3′
Pr0406 IRES-M_R 5′ AAGGGTCGCTACAGACGTTG 3′
Pr0037 IRES-R 5′ ACATATAGACAAACGCACACC 3′
Pr0247 IRES-R2 5′ ATAACATATAGACAAACGC 3′
Pr0628 JCsp_f1 5′ CTTTTAGGGTTGTACGGGAC 3′
Pr0627 Jcsp_f4 5′ CATGCAGATCTATCAAGGCC 3′
Pr0635 JCsp_R2 5′ AACCAAAAACCCCTCCCCCAA 3′
Pr0038 JCV-R 5′ AGCATATGTTTGAGGAGTTA 3′
Pr0556 JHDM1D-AS1_F 5′ ATTGTAATCCCCAATGTTGGAGG 3′
Pr0555 JHDM1D-AS1_R 5′ TCTTCTGCCCTTGAGCACTC 3′
Pr0629 JKsp_f1 5′ CTTTTAGGGTTGTACGGGAC 3′
Pr0630 JKsp_f2 5′ AAAGGAAGGACCCCGTGCAA 3′
Pr0631 JKsp_f3 5′ CCCCTACCCAATTTCTTTCC 3′
Pr0433 K12-L 5′ TTCCCACGGACATGAAGACTACA 3′
Pr0434 K12-R 5′ ATCCTGCGCACCAATCAACAA 3′
Pr0530 KanR-N_R 5′ AGATTGTCGCACCTGATTGC 3′
Pr0278 KITseq3(1050-) 5′ AGGCATATCCCAAACCGGAG 3′
Pr0180 Klf4_N_R 5′ TGTTACTGCTGCAAGCTGCACC 3′
Pr0272 lacI_C_F 5′ CACTGGTGAAAAGAAAAACC 3′
Pr0409 lacIpro_F 5′ GACACCATCGAATGGCGC 3′
Pr0647 lacIpro_F2 5′ CGGCGGTGCTCAACGGCCTC 3′
Pr0722 lacIpro_F3 5′ CTTGCATGCACCATTCCTTG 3′
Pr0762 lacIpro_R1 5′ AGATGGCGCCCAACAGTCC 3′
Pr0724 lacIpro-B_F 5′ CCGCCTTTGAGTGAGCTGATA 3′
Pr0006 LargeT antigen innerF1 5′ GATGTATAGTGCCTTGACTAGAGATCC 3′
Pr0039 Lats2#11 5′ CACGTGGAGAATGTCATCAA 3′
Pr0199 Lats2#2 5′ AGCTGGACACTCACGCTCTG 3′
Pr0370 LEU1pro_F 5′ ACGCAATATTATCGATATCCC 3′
Pr0478 LEU2-C_F 5′ TGCAGGTATCAGAACTGGTG 3′
Pr0169 LEU2pro_F 5′ AAGCGTTCATGACTAAATGCTTGC 3′
Pr0270 LTA_M_F 5′ ACTCACTGCGTTCCAGGCAATG 3′
Pr0144 LTAlarge_upR 5′ CATTCCACCACTGCTCCCAT 3′
Pr0617 Luc inner_F1 5′ CACGTTCGTCACATCTCATCTACC 3′
Pr0146 Luc_R 5′ ATGTCCACCTCGATATGTG 3′
Pr0546 luc2-C_F 5′ TGGACGAGGTGCCTAAAGG 3′
Pr0331 Luc-C_F 5′ AGCACGGAAAGACGATGACGG 3′
Pr0615 luc-C_F2 5′ ACTGACCGGCAAGTTGGAC 3′
Pr0632 Luc-M_R 5′ GTATCCCTGGAAGATGGAAGCG 3′
Pr0678 lysA.extF 5′ TACGGGAAAGGCTGATGTAGTTCTCAC 3′
Pr0679 lysA.extR 5′ TGCGTTGGTCGTCCATGCCAAAATG 3′
Pr0040 M13 Forward(-20) 5′ TTGTAAAACGACGGGCCAGT 3′
Pr0410 M13_-40 5′ GTTTTCCCAGTCACGACGTTGTA 3′
Pr0275 M13_ori-N_R 5′ TAAGGCGCTGGCAAGTGTAG 3′
Pr0349 M13fwd 5′ GTAAAACGACGGCCAGT 3′
Pr0581 M13Fwd_R 5′ ACTGGCCGTCGTTTTCA 3′
Pr0160 M13R 5′ CAGGAAACAGCTATGAC 3′
Pr0042 M13-reverse 5′ AAACAGCTATGACCATGTTCA 3′
Pr0268 mAhr_#1 5′ CTAAACCCAGACTCTGCACAAGGAG 3′
Pr0269 mAhr_#2 5′ AGCCCAGTGAAGCTGGCGCTGG 3′
Pr0266 mAhr_M_F 5′ AACTGGCTTTGTTTGCAATAG 3′
Pr0267 mAhr_M_R 5′ AGCAGTCCCCTGTAAGCTGG 3′
Pr0282 mAmot-M#1 5′ AGGCCAGCCTGACTTCAGC 3′
Pr0283 mAmot-M#2 5′ ATAGCAAAAGGGTCAGCTGG 3′
Pr0151 MAZ-M_R 5′ CCAACTCCTATTTCCCTA 3′
Pr0152 MAZ-M_R2 5′ ACAGTGGGAGCAGTTGTAGG 3′
Pr0340 MBP_937-993 5′ CCCAGAAAGGTGAAATCATG 3′
Pr0325 mCENP-C-N_R 5′ AGCCTGAACTGATCCACCAG 3′
Pr0520 mCharry-check_F 5′ TGGAGGGCTCCGTGAACG 3′
Pr0521 mCharry-check_R 5′ TGTAGATGAACTCGCCGTCC 3′
Pr0522 mCharry-mut_F 5′ ACGGCCACGAGTTCGAGT 3′
Pr0453 mCherry-C_F 5′ ACTACGACGCTGAGGTCAAG 3′
Pr0517 mCherry-C_R 5′ ACTGTTCCACGATGGTGTAG 3′
Pr0526 mCherry-check_R2 5′ ATCCCCGACTACTTGAAGCTGT 3′
Pr0529 mCherry-check_R3 5′ TCCCCCGACTACTTGAAGCTG 3′
Pr0527 mCherry-check_R4 5′ CAGCTTCAAGTAGTCGGGGA 3′
Pr0523 mCherry-check-wt_F 5′ GGCCACGAGTTCGAGA 3′
Pr0532 mCherry-check-wt_F2 5′ acGGCCACGAGTTCGAGA 3′
Pr0518 mCherry-N_R2 5′ ACCTTCAGCTTGGCGGTCTG 3′
Pr0398 mCherry-N_rev 5′ GTTCACGGAGCCCTCCATGT 3′
Pr0113 mCMYC_R 5′ TTATGCACCAGAGTTTCGAAG 3′
Pr0045 ME:1250RV (Sugano R) 5′ TGTGGGAGGTTTTTTCTCTA 3′
Pr0046 ME-1290RV 5′ ATAAGCTGCAATAAACAAGTTAACAAC 3′
Pr0043 ME-720FW 5′ CCGGATCCGGTGGTGCAAATC 3′
Pr0044 ME-735FW(SuganoF) 5′ GGATGTTGCCTTTACTTCTA 3′
Pr0485 Mef2c-C_F 5′ TTGACAGCTTGAGCAGCTGTAG 3′
Pr0320 mEGFP-down2 5′ TACAAGTACTCAGATCTCG 3′
Pr0718 metA internal F 5′ TAACCTGATGCCGAAGAAGATTGAAAC 3′
Pr0719 metA internal R 5′ AGTAAATTACCGTGACTACGCCAGCTC 3′
Pr0698 metA.ext.F 5′ CATCAAATAAAGCGAAAGGCCATCCGTC 3′
Pr0699 metA.ext.R 5′ CATTAGTGTAACTGATGGTGCCGTTAACC 3′
Pr0700 metL.ext.F 5′ TGCGAAAATCTGCCATCTGGCAAGG 3′
Pr0701 metL.ext.R 5′ CCACGATATGACGAATACCGTTATTCCAG 3′
Pr0738 mGNAI-B_F 5′ AACTATGAGTGGCTGGAAGC 3′
Pr0737 mGNAI-B_R 5′ CCACTTTCTTCTTAGCTGGG 3′
Pr0345 mGrm5_F1 5′ ACAAAGTTCATGAGAGGAAG 3′
Pr0367 mGrm5_F2 5′ ACAACAGGTAACTACAAGAG 3′
Pr0368 mGrm5_F3 5′ AATTTTACTGGAGTTTCTGG 3′
Pr0369 mGrm5_F4 5′ CTCATCTGTATTCAGCTGGG 3′
Pr0378 mGrm5_F5 5′ AACCAAACGGCGGTCATCAA 3′
Pr0380 mGrm5_F6 5′ AACAGAGAACCCGAGGTGAA 3′
Pr0346 mGrm5_R1 5′ CAATGTATTCAATGAGATGGT 3′
Pr0379 mGrm5_R2 5′ TGTGTGTCCTTGGCATTTTT 3′
Pr0382 mGrm5_R3 5′ GGCCACTAGAAGATAATCTGCC 3′
Pr0419 mGrm5_R4 5′ CATACTGTTGCTGCCTCAGA 3′
Pr0479 MHCH2-K_R 5′ AGGAGAGACCCGCAGGCCAGAC 3′
Pr0366 MINT_RAM7#2 5′ TCTGGTGAATGTCTCTCTGG 3′
Pr0285 MINT_RAM7_F 5′ ATCACAAGACAGGAAGAGCC 3′
Pr0284 MINTdeltaC-F 5′ ACCAGGAAGAGACTGGAGCG 3′
Pr0288 MINTdeltaC-F2 5′ TTGCCTCTCAGCAGGAGCAGG 3′
Pr0451 mKif2-M_F 5′ AGCCTGGGAACAGAGCTGCTGC 3′
Pr0035 mKLF4 innerF1 5′ GACATCAATGACGTGAGCCC 3′
Pr0056 mKLF4 innerF2 5′ CACACCTGCGAACTCACACA 3′
Pr0595 mKlf4_MF 5′ ACATCAATGACGTGAGCCCC 3′
Pr0578 mKO2-M_F 5′ AAGGGCGACGTGACCATGTACC 3′
Pr0494 mKO2-N_R 5′ ATGTCCCTCGTAAGGTCTGC 3′
Pr0645 mKOk-C_F 5′ AAGACTACTTACAAGGCGGC 3′
Pr0726 mKO-N 5′ TGGAGCAGCGAAATCAACG 3′
Pr0729 mKO-N_R 5′ ACTAAGTCAAACGAGAAAGG 3′
Pr0352 MMLV-pol_F 5′ AGGACCTTACACAGTCCTGCTG 3′
Pr0364 MMLV-pol_F2 5′ ATACACGCCGCCCACGTGAAGG 3′
Pr0459 MMTV-LTR#1 5′ AGCCCTGCGAGCACGAACCGCAAC 3′
Pr0460 MMTV-LTR#2 5′ ACTTGCAACAGTCCTAACATTCAC 3′
Pr0007 mMYC innerF1 5′ CCTTCATCAAGAACATCATCATCC 3′
Pr0054 mOCT3/4 innerF1 5′ ATGCCGTGAAGTTGGAGAAG 3′
Pr0055 mOCT3/4 innerF2 5′ TCTGTTCCCGTCACTGCTCT 3′
Pr0400 moe3_055R 5′ AGAGTAGAGAGATATCAATGGCTA 3′
Pr0188 mPerforin_M_F 5′ ATGGCTACTCTTATGCTGGCCTG 3′
Pr0502 mRFP1-C_F 5′ ATGGCCAAGAAGCCCGTGCAGC 3′
Pr0443 mRFP1-inner1 5′ AGTGGGAGCGCGTGATGAAC 3′
Pr0674 mRFP-M_R 5′ GAAGGACAGCTTCAAGTAGTCG 3′
Pr0057 mSOX2 innerF1 5′ ACAACTCGGAGATCGGCAAGC 3′
Pr0111 mSOX2_R 5′ ATGTGCAGTCTACTGGGCGCA 3′
Pr0181 mStr-C_F 5′ ATCGTCGGCATCAAGTTGGAC 3′
Pr0577 mTurquoise2-M_F 5′ AAGGCCAACTTCAAGATCCG 3′
Pr0574 mVenus-M_F 5′ ACTACAACAGCCACAACGTC 3′
Pr0182 myc_C_F 5′ TGACCAGATCCCTGAATTGG 3′
Pr0178 myc_M_R 5′ GATGATGATGTTCTTGATGA 3′
Pr0594 Myc-1169F 5′ TTGCCCTGCGTGACCAGATCCC 3′
Pr0407 Myc-M_F 5′ AGTGGTCTTTCCCTACCCGC 3′
Pr0019 N-CMV-30 5′ AATGTCGTAATAACCCCGCCCC 3′
Pr0148 Neo-C_F 5′ GGCGGACCGCTATCAGGACATA 3′
Pr0147 Neo-M_F 5′ GATCTCCTGTCATCTCAC 3′
Pr0145 Neo-M_R 5′ GTGAGATGACAGGAGATC 3′
Pr0321 Nex_F 5′ TGTTCGCCAGGCTCAAGG 3′
Pr0195 NM_005228.3_3745..3762 5′ CTGGACAACCCTGACTAC 3′
Pr0196 NM_005228.3_520..502 5′ CAATGAGGACATAACCAGC 3′
Pr0004 nmt1Fw 5′ GCTGTAAAACACCACGAGAC 3′
Pr0133 nmt1-Fw2 5′ TAAGGATGATGACGATAAAC 3′
Pr0049 nmt1-rev 5′ AGACATTCCTTTTACCCTTA 3′
Pr0504 nmt1ter_F 5′ ATCACCCAAACCTGTTAGCG 3′
Pr0428 nmt1ter_R 5′ AACTACATCTAACACGAAGG 3′
Pr0505 nmt1ter_R2 5′ AGTACTCGTTGTCGGAGATC 3′
Pr0183 Oct4_N_R 5′ TGAGGTCCACAGTATGCCATCC 3′
Pr0661 OI bacpro_F 5′ AAGCGGACACTTTGGGGAAC 3′
Pr0442 OI b-actin S74868 (2017-2035) 5′ GCAGATGGGCGTGTCTTTG 3′
Pr0348 ONL-M_R 5′ AGTGGGCCACGGCGTCCTCC 3′
Pr0765 oriP_F 5′ ATACCCAGTAGTAGAGTGGG 3′
Pr0241 OsTIR1 codon plus_F1 5′ TCTGCTGAGAACCCCTAACC 3′
Pr0582 OsTIR1cp-M_F 5′ TAAACTGACTTCTGCCCTGG 3′
Pr0583 OsTIR1cp-M_R 5′ TCATCTTTGTCAGATCACTG 3′
Pr0734 p10pro-B_R 5′ TAAAGGTCCGTATACTCCGG 3′
Pr0276 p15Aori_F 5′ TATAGTCCTGTCGGGTTTCG 3′
Pr0389 p15Aori_R 5′ AGTTGGTAGCTCAGAGAACC 3′
Pr0290 p21WAF1F1 5′ ATGTCAGAACCGGCTGGGGATGTCCGTCAG 3′
Pr0289 p21WAF1R1 5′ TTAGGGCTTCCTCTTGGAGAAGATCAGCCG 3′
Pr0293 p53AIP1F1 5′ ATGGGATCTTCCTCTGAGGCGAGCTTCAG 3′
Pr0294 p53AIP1R1 5′ TCACTGCAACCTCAACGGTGCTTTTTTCTG 3′
Pr0299 p53DINP1aF1 5′ ATGTTCCAGAGGCTGAATAAAATGTTTGTG 3′
Pr0300 p53DINP1aR1 5′ TTAGTAATTGTACTGACGCGGGCAGGGC 3′
Pr0297 p53R2F1 5′ ATGGGCGACCCGGAAAGGCCGGAAGC 3′
Pr0298 p53R2R1 5′ TTAAAAATCTGCATCCAAGGTGAAGACGTTATC 3′
Pr0091 pAdex_F 5′ TCACATCCAGCATCACAGG 3′
Pr0050 pAT153-Forward 5′ AGTCTATTAATTGTTGCCGGGAAGC 3′
Pr0051 pAT153-Reverse 5′ ATGTAACTCGCCTTGATCGTTGG 3′
Pr0332 Pause site 5′ TAGGCTGTCCCCAGTGCAAG 3′
Pr0120 Pause site_R 5′ GTTCTGGCACCTGCACTTGC 3′
Pr0164 pAxCA_F1 5′ GGCTTCTGGCGTGTGACCGGC 3′
Pr0165 pAxCA_R1 5′ CAGAGGGAAAAAGATCTCAGTGG 3′
Pr0166 pAxCALNLF1 5′ CACTGCATTCTAGTTGTGGTTTGTCC 3′
Pr0208 PAXCWF1 5′ GCCTCAGCTCCTCGGTCACATCCAGG 3′
Pr0209 PAXCWF2 5′ TCGGTCACATCCAGCATCACAGGCTGG 3′
Pr0114 pAxcwF4 5′ AAATCGATTGTCGACTCGCG 3′
Pr0134 pAxcwit2-Fw 5′ CCTCAATCTGTATCTTCATC 3′
Pr0135 pAxcwit2-Rv 5′ GCGTAACCGAGTAAGATTT 3′
Pr0115 pAxcwR2 5′ TCATCGTACCTCAGCACCTT 3′
Pr0116 pAxcwR3 5′ CGAAACGAGGAGATATGCTG 3′
Pr0058 pAxEF F2 5′ TCAAGCCTCAGACAGTGGTTC 3′
Pr0059 pAxEF R2 5′ GATGAGTTTGGACAAACCAC 3′
Pr0041 pAxEF_F1 5′ TCATTCTCAAGCCTCAGACA 3′
Pr0060 pBABE3′ 5′ ACCCTAACTGACACACATTCC 3′
Pr0061 pBABE5′ 5′ CTTTATCCAGCCCTCAC 3′
Pr0544 pBAC_lac_F 5′ CGCCAGGGTTTTCCCAGTCACGAC 3′
Pr0545 pBAC_lac_R 5′ CAGGAAACAGCTATGACC 3′
Pr0062 pBACe3.6_F 5′ ACCTGGCAAAATCGGTTACGGTTGAG 3′
Pr0063 pBACe3.6_R 5′ AGGCTTGAGTCGCTCCTCCTG 3′
Pr0461 pBMSA#1 5′ TAGCCTCATCATCACTAGATGG 3′
Pr0140 pBR_BamHI_F2 5′ TCGCTTCGCTACTTGGAGC 3′
Pr0141 pBR_BamHI_R2 5′ ATGTCGGCGATATAGGCGC 3′
Pr0139 pBR_EcoRI_R 5′ GCCTATGCCTACAGCATC 3′
Pr0064 pBR322_BamHI_F 5′ CACTATCGACTACGCGATCA 3′
Pr0210 pBR322_BamHI_F2 5′ TCGCTTCGCTACTTGGAGC 3′
Pr0065 pBR322_BamHI_R 5′ ATGCGTCCGGCGTAGA 3′
Pr0211 pBR322_BamHI_R2 5′ GACTCCTGCATTAGGAAG 3′
Pr0559 pBS423_seq3 5′ GCTCAGATGCAAGCACATCGAGG 3′
Pr0750 pBS423_seq3_2 5′ TGCGACGATGACTACTCCCA 3′
Pr0751 pBS423_seq3_3 5′ CAACGAATATGTGCAGGGGA 3′
Pr0066 pCA-bgter 5′ ATTAGCCAGAAGTCAGATGCTC 3′
Pr0328 pCAG-F 5′ TTCTCCATCTCCAGCCTCGG 3′
Pr0330 pCAG-F_V2 5′ ATGGTAATCGTGCGAGAGGG 3′
Pr0495 pCAG-F_V3 5′ TTCTCCCTCTCCAGCCTCG 3′
Pr0614 pCAGGS_R1 5′ TTTGCCCTCCCATATGTCCT 3′
Pr0506 pCMV-IE94_F 5′ ATGACGCAAATGGGCGTTCC 3′
Pr0239 pCO12_F 5′ AGTGATAGAGCTCTTGCC 3′
Pr0240 pCO12_R 5′ TCCCTTAAGGAGTACCTACC 3′
Pr0067 pCold-F 5′ ACGCCATATCGCCGAAAGG 3′
Pr0069 pCold-F2 5′ GTAAGGCAAGTCCCTTCAAGAG 3′
Pr0068 pCold-R 5′ GGCAGGGATCTTAGATTCTG 3′
Pr0413 Pcpro_F 5′ AGCCTGTTCGGTTCGTAAAC 3′
Pr0070 pDONR_F 5′ TCGCGTTAACGCTAGCATGGATCTC 3′
Pr0071 pDONR_R 5′ GTAACATCAGAGATTTTGAGACAC 3′
Pr0212 pDUAL-Fw 5′ ATAACAATTTCACACAGG 3′
Pr0646 pET_lacIpro_F2 5′ TCGATCCTCTACGCCGGACG 3′
Pr0723 pET-B_F 5′ TCGGTGATGTCGGCGATATA 3′
Pr0191 pET-check-F 5′ CCGCAAGGAATGGTGCATGC 3′
Pr0192 pET-check-R1 5′ GACAGCTTATCATCGATAAGCTT 3′
Pr0748 PG 5′ TGTATCTTATGGTACTGTAACTG 3′
Pr0073 pGCAP_F 5′ CTCAGTGGATGTTGCCTTTAC 3′
Pr0074 pGCAP_R 5′ GCATTCTAGTTGTGGTTTGTCC 3′
Pr0076 pGEX_F 5′ GGGCTGGCAAGCCACGTTTGGTG 3′
Pr0603 pGEX_F1 5′ CTGTCATAACACTGTGTTACC 3′
Pr0604 pGEX_F2 5′ GGACTCCTGAAATCTTTACTGC 3′
Pr0605 pGEX_R3 5′ GAAGATGGTGTAGTGGGTAAG 3′
Pr0759 pGEX_tacp-F 5′ ACGTTATCGACTGCACGGTG 3′
Pr0213 pGEX3′ 5′ CCGGGAGCTGCATGTGTCAGAGG 3′
Pr0403 pGEX-F2 5′ ACATGGACCCAATGTGCCTG 3′
Pr0455 pGEX-ptac_up-F 5′ AAGGCGCACTCCCGTTCTGG 3′
Pr0077 pGEX-RSEQ 5′ CCGGGAGCTGCATGTGTCAGAGG 3′
Pr0243 PGK_N_rev 5′ TGCTAAAGCGCATGCTC 3′
Pr0500 PGKpA_R 5′ ATCCTTCCATTCAAAATGTAGG 3′
Pr0249 PGKpro_F 5′ ATTCTGCACGCTTCAAAAG 3′
Pr0335 pGL3_RV4 5′ GACGATAGTCATGCCCCGCG 3′
Pr0078 pGL3basic_4406F 5′ TATCTCGGTCTATTCTTTTG 3′
Pr0217 pGL3-RV3 5′ CTAGCAAATAGGCTGTCC 3′
Pr0079 pGL4-136R 5′ CTTCGAGTGGGTAGAATGGC 3′
Pr0081 pGL4-4174F 5′ TAGCAAAATAGGCTGTCCCC 3′
Pr0665 pGL4ins_F 5′ CGATAGTACTAACATACGCTCTCC 3′
Pr0666 pGL4ins_R 5′ TAGCGCTTCATGGCTTTGTG 3′
Pr0664 pGL4pA_R 5′ GGAAGGAGCTGACTGGGTTGAA 3′
Pr0129 PGV_CCw 5′ CTTTATGTTTTTGGCGTCTTCCA 3′
Pr0130 PGV_Cw 5′ TGTATCTTATGGTACTGTAACTG 3′
Pr0625 phKLK3proRev 5′ GATTAAACGACAGGTCAGTCATGG 3′
Pr0735 PHNpro-M_R 5′ GCGAGATGGTTATCATTTTA 3′
Pr0232 Phox2b#1 5′ TGACTCTTCCAGGGACGACG 3′
Pr0218 phRLF1 5′ TCGCCACCTCTGACTTGAGCGTCG 3′
Pr0219 phRLR1 5′ CAATATTATTGAAGCATTTATCAGG 3′
Pr0083 phRLR2primer 5′ CCAATAGGTGCCTATCAGAAACGC 3′
Pr0084 pJB8-Forward 5′ ACGAGGCCCTTTCGTCTTC 3′
Pr0085 pJB8-Reverse 5′ TTGTTAGATTTCATACACGGTGCC 3′
Pr0086 pJG4-5_R 5′ AAGCTTTATTGTACGATCTG 3′
Pr0720 pKD3verN3 5′ CGCAAGATGTGGCGTGTTACGGTG 3′
Pr0253 pKS145-P_F 5′ TATTCAACATTTCCGTGTCGC 3′
Pr0254 pKS145-P_R 5′ AGTCTATTAATTGTTGCCGGGAAGC 3′
Pr0336 pKS145-P_R2 5′ TTTGGTATGGCTTCATTCAGCTCCG 3′
Pr0087 pMAMneo-Forward 5′ TCTTGTATTGTCTCTTTCTTGTCTGG 3′
Pr0088 pMAMneo-Reverse 5′ ACCTTAGAGCTTTAAATCTCTGTAGG 3′
Pr0220 pME18S-FL3-F 5′ TCGAGCACTGTTGGCCTACT 3′
Pr0222 pME18S-FL3-R 5′ CCTGCAGCTCGAGCACATGT 3′
Pr0230 pMFG_1 5′ TGCTGGACTAAGTAGAGAG 3′
Pr0238 pMFG_2 5′ AGGATATCAGTGGTCCAGGC 3′
Pr0089 pMFG_F 5′ CTTCTCTAGGCGCCCATATG 3′
Pr0090 pMFG_R 5′ GCCTGGACCACTGATATCCT 3′
Pr0397 pMOE-2 5′ CTAAGTGAGTTGTGTGGAAC 3′
Pr0596 pMT2_F 5′ TTGCCTTTCTCTCCACAGGT 3′
Pr0600 pMT2_F2 5′ TTGCGAATTGTTCACGGACG 3′
Pr0607 pMT2_F3 5′ ATGTCACTGTTCGTCTCCAC 3′
Pr0601 pMT2_R1 5′ GGGACACGGCGACGATGCAG 3′
Pr0602 pMT2_R2 5′ TGAACTCGTTCCTGAGCGG 3′
Pr0351 pMXs-3LTRup_R 5′ ATTCCCCCCCTTTTTCTGG 3′
Pr0365 pMXs-3LTRup_R2 5′ TGGGGTCTTTCATTCCCCCC 3′
Pr0311 pNCMO2_F1 5′ AACTTTTGATTCGCTCAGGCG 3′
Pr0224 pOTB7_F(7-32) 5′ AACGCGGCTACAATTAATACATAACC 3′
Pr0225 pOTB7_R(358-335) 5′ GTACTGCAGCCGATTCATTAATGC 3′
Pr0235 pP10_F 5′ CTTTAATTCAACCCAACAC 3′
Pr0236 pPolyhedrin_F 5′ TTAAAATGATAACCATCTCG 3′
Pr0250 PRE_rev 5′ AGCAATAGCATGATACAAAGGC 3′
Pr0305 prfAnoATG 5′ AAGCCTTCTATCGTTGCCAAAC 3′
Pr0306 prfATAARev 5′ TTATTCCTGCTCGGACAACG 3′
Pr0710 proC.Ext.F 5′ CTCCCTTCCCATTATTGTCATTTATCCTC 3′
Pr0711 proC.Ext.R 5′ GTCATGAGAATAGCGATCATACCATCAAAC 3′
Pr0465 pRx#1 5′ TCCCCGAGCTCAATAAAAGAGC 3′
Pr0274 pSC101_ori_F 5′ TTTTCCAGCAAAGGTCTAGC 3′
Pr0092 pSMY_F 5′ ATACATCTGTCACGTAAACC 3′
Pr0093 pSMY_R 5′ AATTTGCTTTAATCAAGCTC 3′
Pr0343 pSRa-Forward 5′ AAAGCTCAGGTCGAGACCGGGC 3′
Pr0509 pT2KXIG#1 5′ AGGAAACAGCTATGACCATG 3′
Pr0560 pTBR101CM_seq3 5′ CGCGCTTCCGAGAAGGTGTGGA 3′
Pr0561 pTBR101CM_seq7 5′ AACGCGCGAGGACTGGATAG 3′
Pr0094 pTrcHis-F 5′ CATGGTATGGCTAGCATGACTGGT 3′
Pr0095 pTrcHis-R 5′ CCGCTTCTGCGTTCTGATTTAATC 3′
Pr0301 Ptx3_F 5′ ACCAAACTACAGAAACACC 3′
Pr0096 pUAST3′ 5′ AACCAAGTAAATCAACTGC 3′
Pr0097 pUAST5′ 5′ ATCTTAGTCATCAAATTGTG 3′
Pr0536 pUC-CAPbs_up_F 5′ TCATTAATGCAGCTGGCACG 3′
Pr0739 pUC-CAPbs_up_F2 5′ GTGAGCGCAACGCAATTAATG 3′
Pr0310 pUC-M13_-100 5′ ATTACGCCAGCTGGCGAAAGG 3′
Pr0554 PuroR_F 5′ AACCTCCCCTTCTACGAGCG 3′
Pr0423 PuroR-rev 5′ AGGCGCACCGTGGGCTTGTA 3′
Pr0246 R4-M_R 5′ ATGTGGTTGTTGGATTGCTTCAA 3′
Pr0507 RARbeta_LBD 5′ TTCATGTCCTTCAGAATTCTCC 3′
Pr0508 RARgamma_LBD 5′ TCAAACATCTCCGGGTTCTC 3′
Pr0469 RDB01163#1 5′ AAGTAAAACCACCTTGGAAG 3′
Pr0480 RDB01236#1 5′ ACCTCCTGGTCTGTTCTGTGAG 3′
Pr0481 RDB01239#1 5′ AGTCACAGAAGGTGTTTCTGAG 3′
Pr0482 RDB01240#1 5′ AGCCTCCACAGCCTCCTCACAG 3′
Pr0483 RDB01240#2 5′ TCAACCACCACAACCTGCTG 3′
Pr0513 RDB01269#1 5′ AGGAGGTCTACACCACGCTG 3′
Pr0514 RDB01269#2 5′ AAGCTCAGGAGCTATGCCTC 3′
Pr0441 RDB01290#1 5′ TTTGGGGTTGCCTCACAGGG 3′
Pr0446 RDB03878#1 5′ AAGCTTTGCAGAAGATGCTG 3′
Pr0447 RDB03878#2 5′ ATACAACAATGTCCAAGAGG 3′
Pr0535 RDB03958#1 5′ TTCTAAGATGCGAGGCCAAG 3′
Pr0445 RDB04134#1 5′ ATGACCTCTTTATAGCCACC 3′
Pr0487 RDB04487#1 5′ TACCACATAAGTCCAGTAGTTC 3′
Pr0491 RDB04487#2 5′ AGTGCGTACTGTTCGATGAG 3′
Pr0422 RDB06771#1 5′ ATGGAGGATGGCAGTGATGTGG 3′
Pr0438 RDB07098#1 5′ ACTTACTCTGTGCCTTGATTAG 3′
Pr0468 RDB07388#2 5′ TGAGCCAAGATCGTGCC 3′
Pr0467 RDB07570#1 5′ TCAGTACAGACGGGGCTTCACC 3′
Pr0221 RDB08068_F1 5′ GACATTTGTGGGCTGTTTACC 3′
Pr0363 RDB13201#1 5′ AATGTCCTCACAAACTGTACAG 3′
Pr0307 RDB13509#1 5′ TTAGGAGCAGATACGAATGG 3′
Pr0287 RDB13513#1 5′ AGATACTGTCCTCGAAGGG 3′
Pr0302 RDB13535#1 5′ TGGTTGGTGGGGTATTAATG 3′
Pr0326 RDB13947#1 5′ TTCCTGCTCAGATCTCG 3′
Pr0337 RDB13967#1 5′ ATCCTTCTTCTGCGCCTTAG 3′
Pr0339 RDB13967#2 5′ AGTAATGTCTCATTCACCCAG 3′
Pr0386 RDB14052#1 5′ AGTACCCCAGTGCTTTTCCG 3′
Pr0387 RDB14052#2 5′ AGCCCTGTGTTACTTAATGG 3′
Pr0388 RDB14052#3 5′ ACTCTATTACTGAGGGGTACCG 3′
Pr0390 RDB14052#4 5′ AGATCCCGAGGTGAAATAATAG 3′
Pr0474 RDB14058#1 5′ AAGCTTGCATTCATTTCATACG 3′
Pr0417 RDB14113#1 5′ ATTCTCATCTTGGGCATCG 3′
Pr0418 RDB14115#1 5′ TATGCCGCCTTTGCTAGC 3′
Pr0414 RDB14118#1 5′ TGGATGAGCTCAGGGATAC 3′
Pr0415 RDB14118#2 5′ AAAAGGAGACTGGAAGAGGC 3′
Pr0416 RDB14118#3 5′ ACCATCTCAGCCCTTCTG 3′
Pr0394 RDB14154#1 5′ TGTCTAGAGCTCGAGGTCTC 3′
Pr0395 RDB14246#1 5′ TGGAAGGTGCAGGTTGG 3′
Pr0404 RDB14252#1 5′ AGATGTGCTATACACTTTTGC 3′
Pr0396 RDB14267#1 5′ AGGCTGGGGTGATAATGC 3′
Pr0429 RDB14500#1 5′ TTGCACAACCAGACAGACCG 3′
Pr0430 RDB14500#2 5′ AGGCCCTGGTAAATAATCGG 3′
Pr0440 RDB14587#1 5′ TGTGCGATCTTGTTGACAG 3′
Pr0510 RDB15025#1 5′ ATGTGCGAGTTGTTTACAATAG 3′
Pr0475 RDB15053#1 5′ AACATGCTGCTGTCCCACTG 3′
Pr0499 RDB15053#2 5′ CAACTCTAGGCTGATGGACT 3′
Pr0669 RDB15137#1 5′ TGCTCACCATatctgcag 3′
Pr0727 RDB15217#1 5′ GCAGCAGCAACAGGAAGTTATG 3′
Pr0524 RDB15263#1 5′ ATCCCGTCATAAAAGGATTGGG 3′
Pr0525 RDB15263#2 5′ ATTGATCATCTAGGGATGCG 3′
Pr0503 RDB15318#1 5′ GGCTTGTTCCAGTGTCAGAG 3′
Pr0660 RDB15780#1 5′ TAAGGCATCTGGTTGGTCAG 3′
Pr0550 RDB15793_F1 5′ ACTGCTTACTGGCTTATCGAA 3′
Pr0549 RDB15793_R1 5′ CCTACAGGTGGGGTCTTTCA 3′
Pr0547 RDB15797#1 5′ TTGCAGGCGTTACACGATG 3′
Pr0552 RDB15815#1 5′ AGACAAGTTGGTAATGGTAGC 3′
Pr0548 RDB15879#1 5′ ACAAGGAGTGGACGAAGC 3′
Pr0557 RDB15889_R1 5′ CTGGACCACTGATATCCTGTC 3′
Pr0572 RDB15920_F 5′ AAGCCCTCACAGCTCCATAG 3′
Pr0610 RDB16713_F1 5′ ATGATAACCGGTGCCGCTAC 3′
Pr0612 RDB16713_F2 5′ GCAGGTTAGAGGGTATTTCC 3′
Pr0047 RDB16713_F3 5′ CCGGCGCACGATATAAACAG 3′
Pr0611 RDB16713_R1 5′ TTTGGGCGAGTGCTCACCTC 3′
Pr0613 RDB16713_R2 5′ TGCTTCAGAGGCGAGCTCTC 3′
Pr0656 RDB17459_F1 5′ ACGACGGTCTGCGTTTCGCA 3′
Pr0670 RDB17459_F2 5′ CATCAAAGTTGGTGAAGAAG 3′
Pr0728 RDB17459_F3 5′ ATCGCGATGCAGTCTGGTAAG 3′
Pr0655 RDB17459_R1 5′ GGTACCAGTCACGTCAGTAG 3′
Pr0432 Red-C_F 5′ AAGCCCGTGCAGCTGCCCGGCG 3′
Pr0329 Red-N_R 5′ TCGATCTCGAACTCGTGG 3′
Pr0184 rEF1a-C_F 5′ AATTTGCCCCTTTGAGTTTGG 3′
Pr0312 repB-C_F 5′ AAAAAGCCGATGAAGATGG 3′
Pr0098 Rev primer 5′ GGAAACAGCTATGACCATG 3′
Pr0099 reverse 5′ GGAAACAGCTATGACCATG 3′
Pr0100 reverse-2 5′ GCGGATAACAATTTCACACAGG 3′
Pr0543 Reverse2_R 5′ CCTGTGTGAAATTGTTATCCGC 3′
Pr0264 Rluc8.6-535-C_F 5′ ACGCTCCAGATGAAATGG 3′
Pr0579 RLuc8.6-M_F 5′ TATGGAGAGTGTCGTGGACG 3′
Pr0580 RLuc8-M_F 5′ AGAAGATCATCTTCGTGGGC 3′
Pr0265 Rluc8-m1dN3-C_F 5′ ACTTCCTCCAGGAGGACG 3′
Pr0651 RRE-M_R 5′ GATTCTTGCCTGGAGCTGCTT 3′
Pr0488 rrnBT1ter_F 5′ AACGCTCTCCTGAGTAGG 3′
Pr0531 rrnBT1ter_F2 5′ AGCGTTCACCGACAAACAACAG 3′
Pr0473 rrnBT2ter_F 5′ AGAAGGCCATCCTGACGGATGG 3′
Pr0101 RSVpro_F 5′ TGTATTTAAGTGCCTAGCTC 3′
Pr0383 RU5-F 5′ AGACTCAGCCGGCTCTCCAC 3′
Pr0384 RU5-R 5′ AACGGCGCAGAACAGAAAAC 3′
Pr0226 RV4 (pGL3_RV4 ) 5′ GACGATAGTCATGCCCCGCG 3′
Pr0227 RV5F (pGL3_RV5F) 5′ GGGAGGTGTGGGAGGTTTT 3′
Pr0228 RV6R (pGL3_RV6R) 5′ TCATAGCCTTATGCAGTTGCTC 3′
Pr0575 Sc_AGP1-UAS_F 5′ TCTTAAGTTGCGCTGCGAG 3′
Pr0449 SEC71pro_F 5′ ATGGGTAGACGCATCTTATTAC 3′
Pr0102 SEN15-N_R 5′ CTCGACGTAATTTCTCTTCG 3′
Pr0309 SgLPMO10A-M_F 5′ AAGCACAGCAACTGGGCAGCG 3′
Pr0399 Sh-ble C 5′ CAACTGCGTGCACTTCGTGG 3′
Pr0103 SK 5′ CGGCCGCTCTAGAACTAGTGGATC 3′
Pr0104 Smy2-GYM_F 5′ AACGGAATGTCACAACTCC 3′
Pr0231 SNAP_3_F 5′ CTACGAGGGCGGGCTCGCCG 3′
Pr0105 SP6 5′ ATTTAGGTGACACTATAG 3′
Pr0106 SP6 long 5′ CCAGTGAATTGAATTTAGGTGACACTATAG 3′
Pr0200 SpENT50D11_702R 5′ GAATCTACCAGTACACGGCCAG 3′
Pr0342 SRapro_F 5′ ACCTAGACTCAGCCGGCTCTCC 3′
Pr0201 S-Tag F 5′ ATGAACGCCAGCACATGGAC 3′
Pr0107 SV40-3’UTR 5′ ATCTCTGTAGGTAGTTTGTC 3′
Pr0462 SV40NLS_R 5′ ACCTTTCTCTTCTTTTTTGG 3′
Pr0108 SV40pA3’element Reverse 5′ CTCTGACTTGAGCGTCGATTT 3′
Pr0623 SV40polyA_R2 5′ GTGAAATTTGTGATGCTATTGC 3′
Pr0109 SV40polyA-R 5′ TCATTTTATGTTTCAGGTTC 3′
Pr0110 SV40pro_F 5′ TATTTATGCAGAGGCCGAGG 3′
Pr0154 SV40pro_F_V2 5′ TCGGCCTCTGAGCTATTC 3′
Pr0731 SV40pro_ori_F 5′ TTCTCCGCCCCATGGCTGACTAAT 3′
Pr0470 SV40pro_R 5′ TCTGGAATAGCTCAGAGGCC 3′
Pr0496 SV40pro_R_V2 5′ TTTGCATACTTCTGCCTGCC 3′
Pr0516 SV40pro_R2 5′ GACTTTCCACACCTGGTTGC 3′
Pr0257 synthPA_F 5′ TTTCATTACATCTGTGTGTTGG 3′
Pr0112 T3 5′ GCAATTAACCCTCACTAAAGG 3′
Pr0256 T3v2 5′ ATTAACCCTCACTAAAGGGA 3′
Pr0202 T7 5′ GTAATACGACTCACTATAGGGC 3′
Pr0155 T7 terminator 5′ GCTAGTTATTGCTCAGCGG 3′
Pr0261 T7_20bp 5′ TAATACGACTCACTATAGGG 3′
Pr0477 T7_R 5′ CCCTATAGTGAGTCGTATTAgcgg 3′
Pr0244 T7long 5′ CGCCAAGCTCTAATACGACTCACTATAGGG 3′
Pr0203 T7long-2 5′ CGCCAAGCTCTAATACGACTCACTATAGGG 3′
Pr0435 T7-RNA-pol_F 5′ AGGCTGACATGCTCTCTAAGG 3′
Pr0436 T7-RNA-pol_R 5′ AAGCCATGATGTTCTCGTGG 3′
Pr0486 Tbx5-C_F 5′ AGTGCGGGCCTCAGACTGGC 3′
Pr0431 TDH3pro_F 5′ AAATTATTCCCCTACTTGAC 3′
Pr0662 tead4-B_R 5′ TTCTTTCACAAGTCGGTAGA 3′
Pr0372 TEFpro_F 5′ ATAATCATTTGCATCCATAC 3′
Pr0392 TEFpro_R 5′ TTTAGTATGCTGTGCTTGGG 3′
Pr0391 TEFter_R 5′ TCTGGGCAGATGATGTCGAGGC 3′
Pr0138 Tet-On 3G C_F 5′ CGGCCTGGAACTAATCATATGTGG 3′
Pr0333 TetOne oligo 1 5′ accccacagtggggcaagctGAGTCAGTGAGCGAGGAAGCTCGGG 3′
Pr0334 TetOne oligo 2 5′ tggaaaaggcgcaaccccaaCCCCGAAAAGTGCCACCTGACGTCG 3′
Pr0732 tetpro-B_R 5′ TATCACGAGGCCCTTTCGTCT 3′
Pr0204 Tet-r-M_R 5′ AAGAAGACAGTCATAAGTGCG 3′
Pr0764 TetR-N_R 5′ TAACATCTCAATGGCTAAGG 3′
Pr0571 tFucci_f1 5′ GAGGTTTCCAGCCCCAGTACCC 3′
Pr0702 thrA.ext.F 5′ CTGGTGTTTGGTCGCGAAGATTCC 3′
Pr0703 thrA.ext.R 5′ AATGCAATCCTGGCGGCGATACTG 3′
Pr0708 thrC.extF 5′ TCAGTGCTGGGAGCGTTTTTG 3′
Pr0709 thrC.extR 5′ AATCGGCTGACCAAACCAGAGC 3′
Pr0570 TK13386 5′ CTTCAAGAGCCCTACCTTCT 3′
Pr0569 TK6159 5′ AGTTATCCTTGGATTTGG 3′
Pr0568 TK7732 5′ AAGTGATGTTGGAAATTGAAC 3′
Pr0663 Tkpro-B_R 5′ CGTAAACTCCTCTTCAGACC 3′
Pr0439 Tkpro-F 5′ AGGTCCACTTCGCATATTAAG 3′
Pr0121 Tkpro-R 5′ TGGCCACCAAGACCAAACCCCGAGC 3′
Pr0375 TNRC6A_GW1 5′ ATGGAGAGTCAAAAAGTGGAGG 3′
Pr0376 TNRC6A_GW2 5′ AAACCTGCTCTGAGGTGGGGAG 3′
Pr0377 TNRC6A_NES-NLS-GW3 5′ AGCCCTGCTATGGAGCCAAGGG 3′
Pr0658 Tol2#1 5′ ACACCTCTGTCAAGAACTCCTG 3′
Pr0659 Tol2#2 5′ AAACTGGGCATCAGCGCAATTC 3′
Pr0626 TRAIL-N_R 5′ TTCAGCTCGTTGGTAAAGTACACG 3′
Pr0122 TriEx Down primer 5′ TCGATCTCAGTGGTATTTGTG 3′
Pr0171 TRP1pro_F 5′ AGGGCATTGGTGACTATTGAG 3′
Pr0712 trpAB.Ext.F 5′ CAAATTAAGCGCAACGAGAAGATAGAGG 3′
Pr0713 trpAB.Ext.R 5′ CGGACTTGATTTTAATTCTGCTGTAGAGTC 3′
Pr0541 tTA-Ad F 5′ GAGCTGTTCGACCATCAGG 3′
Pr0542 tTA-Ad R 5′ TCGTCAGGCCTTCGATACC 3′
Pr0185 TUB1down_R 5′ AATTCGACGGCAAGGCGGGAG 3′
Pr0186 TUB2_M_F 5′ AGATCACACATTCTCTTGGTGG 3′
Pr0187 TUB2_M_R 5′ ATGTTCTTGGCATCAAACATTTG 3′
Pr0252 TUB2_M_R2 5′ TCATCTTCCACCTCCTTAACGG 3′
Pr0657 tuf-C_F1 5′ TTAACATAGTCGGCGTGCCC 3′
Pr0704 tyrA.ext.F 5′ GGTCAGCAATTGGTGCTCGTACAACG 3′
Pr0705 tyrA.ext.R 5′ GTCTACAGCCATCCGCAGCCATTC 3′
Pr0688 tyrB.ext.F 5′ GCGAAGGCAAACCTGGTCAACGTTCC 3′
Pr0689 tyrB.ext.R 5′ GATTGACCAGCCCCCTACCCTACAATGG 3′
Pr0123 U-19mer 5′ GTTTTCCCAGTCACGACGT 3′
Pr0641 U6pro_F1 5′ CTATAGAGGCTTAATGTGCG 3′
Pr0642 U6pro_F2 5′ AACAGCACAAAAGGAAACTC 3′
Pr0648 U6pro_F3 5′ AGTAATAATTTCTTGGGTAG 3′
Pr0262 UbC-N_R 5′ TGCTGATACTGGGGTTCTAAGG 3′
Pr0158 UbCpro_F 5′ AGGCACCTTTTGAAATGTAATC 3′
Pr0143 URA3-C_F 5′ AACGTTACAGAAAAGCAGGC 3′
Pr0170 URA3pro_F 5′ AAGGAGCACAGACTTAGATTGG 3′
Pr0277 URA3pro_R 5′ TGCAGTTGGGTTAAGAATACTGG 3′
Pr0371 URA4pro_F 5′ ACTATGCTTCGTCGGCATCTCTG 3′
Pr0124 V5 Reverse 5′ ACCGAGGAGAGGGTTAGGGAT 3′
Pr0452 Venus-C_F 5′ TACCTGAGCTACCAGTCCAAGC 3′
Pr0454 Venus-C_F2 5′ AGAAGCGCGATCACATGGTC 3′
Pr0341 Venus-N_R 5′ AGCTTGCCGTAGGTGGCATC 3′
Pr0519 vsp-C_F 5′ ATGGTGGGGCGAGAATGAAC 3′
Pr0457 W01A019C14_5_1420bp 5′ GGTATCTTTTGCAGTTAAGAG 3′
Pr0456 W01A019C14_5_500bp 5′ TTGGGCAGAACTGATTGTAGTCC 3′
Pr0053 WPRE_R 5′ CATAGCGTAAAAGGAGCAAC 3′
Pr0741 WPRE_R2 5′ CCAGGCACAATCAGCATTGG 3′
Pr0229 WT-U3278-1095F 5′ CGTGTTGGGTTGAAGAGGAG 3′
Pr0286 Yap-M_F 5′ AACGATCAGACAACAACATGG 3′
Pr0667 YC3.60pm-C_F 5′ ACCAAGATGAGCAAAGATGG 3′
Pr0668 YC3.60pm-C_F2 5′ AACATCGAGGGTACCGGCGG 3′
Pr0721 YC4.6-M_F 5′ ATTATTCGACAAGGATGGGG 3′
Pr0528 YCX2.6_F1 5′ CGCATGCATACAGAAGAGCA 3′
Pr0125 yEGFP_N 5′ AAAACATTGAACACCATAAC 3′
Pr0126 YER121_F 5′ AAGCAAAGTGTTTATAATGC 3′
Pr0127 YFP_R 5′ GAACTTCAGGGTCAGCTTGC 3′
Pr0128 YMR057c-N_R 5′ ATATGTATGTAAGCAGGCCAT 3′
Pr0675 Zeo-M_R 5′ GAAGTTCGTGGACACGACCT 3′

Related Information

PCR Primers for Detection of Adenovirus Vector
List of STS Markers for Detection of Virus Genes

go to Head


(2011.01.12 T.M.)

2019.11.07