{"id":2415,"date":"2012-02-28T14:03:45","date_gmt":"2012-02-28T05:03:45","guid":{"rendered":"http:\/\/dna.brc.riken.jp:8002\/?page_id=2415"},"modified":"2018-03-14T14:44:04","modified_gmt":"2018-03-14T05:44:04","slug":"manual_07","status":"publish","type":"page","link":"http:\/\/dna.brc.riken.jp\/ja\/manual\/manual_07","title":{"rendered":"\u5fae\u751f\u7269\u30b2\u30ce\u30e0DNA\u306e\u8abf\u88fd"},"content":{"rendered":"

Preparation of Genomic DNA<\/h3>\n
    \n
  1. Suspend bacteria cells in 8 ml of [0.7 M NaCl, 0.1 M EDTA (pH 8.0)] in 50 ml conical tube.<\/li>\n
  2. Add 1 ml of 10 mg\/ml lysozyme in PBS.<\/li>\n
  3. Add 30 ul of 100 mg\/ml labiase.<\/li>\n
  4. Incubate mixture in 37o<\/sup>C water bath for 1 hour.<\/li>\n
  5. Add 1 ml of [0.5 M tris-Cl (pH 7.5), 5% SDS].<\/li>\n
  6. Add 25 ul of 10 mg\/ml protease K.<\/li>\n
  7. Incubate mixture at 60o<\/sup>C for 1 hour.<\/li>\n
  8. Extraction of DNA with phenol.<\/li>\n
  9. Extraction of DNA with phenol-chloroform.<\/li>\n
  10. Extraction of DNA with chloroform-isoamyl alcohol (24:1).<\/li>\n
  11. Precipitation of DNA with cold ethanol.<\/li>\n
  12. Wash precipitated DNA with 70% ethanol.<\/li>\n
  13. Dissolve DNA in 600 ul TE buffer with 1ul of 10 mg\/ml RNaseA.<\/li>\n
  14. Incubate DNA at 37o<\/sup>C for 30 min.<\/li>\n
  15. Add 5 ul of 10 mg\/ml protease K.<\/li>\n
  16. Incubate DNA at 60o<\/sup>C for 1 hour.<\/li>\n
  17. Extraction of DNA with phenol.<\/li>\n
  18. Extraction of DNA with phenol-chloroform.<\/li>\n
  19. Extraction of DNA with chloroform-isoamyl alcohol (24:1).<\/li>\n
  20. Add 100 ul of 3 M sodium acetate (pH5.5).<\/li>\n
  21. Add 1.2 ml cold ethanol.<\/li>\n
  22. Wash precipitated DNA with 70% ethanol.<\/li>\n
  23. Redissolve DNA in 200 ul TE buffer.<\/li>\n
  24. Dilute 2 ul of DNA into 400 ul dH2<\/sub>O and analyze OD260<\/sub>.<\/li>\n<\/ol>\n

    Reconstitution of DNA<\/h3>\n
      \n
    • In the case you received plastic vials contains precipitated DNA with ethanol.<\/li>\n
    • A precipitant might stick to the lid or wall during transportation.<\/li>\n
    • Before opening the tube, please spin down a minute or two at 5,000 g (~7,000 rpm, table top microfuge).<\/li>\n
    • Please remove ethanol with pipet (DO NOT tooch precipitate!)<\/li>\n
    • Immediately after removal of ethanol resuspend the DNA in an appropriate amount of TE buffer (10 mM Tris-Cl, pH 7.5, 1 mM EDTA), and dissolve the DNA pellet by gently tapping with fingers (DO NOT shake vigorously! A little amount of ethanol won’t affect to many applications).<\/li>\n
    • If the DNA is difficult to solve, leave the vial at 4 degreeC overnight to allow the DNA to dissolve.<\/li>\n
    • Once reconstituted in TE buffer, the DNA should be stored at -30 degreeC.<\/li>\n<\/ul>\n

      Related Information<\/h3>\n

      Primers for PCR of rRNA gene<\/h4>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
      Bacteria 16S rRNA<\/td>\n<\/tr>\n
      Name of primer<\/th>\nSequence<\/th>\n<\/tr>\n
      EB-20F<\/td>\n5′ AGTTTGATCCTGGCTC 3′<\/td>\n<\/tr>\n
      EB-350F<\/td>\n5′ TACGGGAGGCAGCAG 3′<\/td>\n<\/tr>\n
      EB-1100R<\/td>\n5′ AGGGTTGCGCTCGTTG 3′<\/td>\n<\/tr>\n
      EB-1400R<\/td>\n5′ ACGGGCGGTGTGTAC 3′<\/td>\n<\/tr>\n
      EB-1530R<\/td>\n5′ AAGGAGGTGATCCAGCC 3′<\/td>\n<\/tr>\n
      \nReference of primer\n
        \n
      • Itoh, T., Kudo, T., Oyaizu, H. and Seino, A.
        \nTwo new species in the genus Actinomadura: A. glomerata sp. nov., and A. longicatena sp. nov.
        \nActinomycetologica 9: 164-177, 1995.
        \nDOI: 10.3209\/saj.9_164.\n<\/li>\n
      • Namwong, S., Tanasupawat, S., Smitinont, T., Visessanguan, W., Kudo, T. and Itoh, T.
        \nIsolation of Lentibacillus salicampi strains and Lentibacillus juripiscarius sp. nov. from fish sauce in Thailand.
        \nInt. J. Syst. Evol. Microbiol. 55: 315-320, 2005.
        \nPMID: 15653893. DOI: 10.1099\/ijs.0.63272-0.\n<\/li>\n<\/ul>\n<\/td>\n<\/tr>\n
      Archaea 16S rRNA<\/td>\n<\/tr>\n
      Name of primer<\/th>\nSequence<\/th>\n<\/tr>\n
      A-20F<\/td>\n5′ TCCGGTTGATCCTGCCG 3′<\/td>\n<\/tr>\n
      A-340F<\/td>\n5′ CCCAGGCCCTACGGG 3′<\/td>\n<\/tr>\n
      A-520R<\/td>\n5′ GTATTACCGCGGCGGCTG 3′<\/td>\n<\/tr>\n
      A-1100R<\/td>\n5′ CGGGTCTCGCTCGTT 3′<\/td>\n<\/tr>\n
      A-1400R<\/td>\n5′ GACGGGCGGTGTGTGC 3′<\/td>\n<\/tr>\n
      \nReference of primer\n
        \n
      • Itoh, T., Suzuki, K. and Nakase, T.
        \nOccurrence of introns in the 16S rRNA genes of members of the genus Thermoproteus.
        \nArch. Microbiol. 170: 155-161, 1998.
        \nPMID: 9683654. DOI: 10.1007\/s002030050628.<\/li>\n
      • Itoh, T., Suzuki, K., Sanchez, P. C. and Nakase, T.
        \nCaldisphaera lagunensis gen. nov., sp. nov., a novel thermoacidophilic crenarchaeote isolated from a hot spring at Mt Maquiling, Philippines.
        \nInt. J. Syst. Evol. Microbiol. 53: 1149-1154, 2003.
        \nPMID: 12892143. DOI: 10.1099\/ijs.0.02580-0.<\/li>\n<\/ul>\n<\/td>\n<\/tr>\n
      Fungi 26S rRNA<\/td>\n<\/tr>\n
      Name of primer<\/th>\nSequence<\/th>\n<\/tr>\n
      ITS5<\/td>\n5′ GGAAGTAAAAGTCGTAACAAGG 3′<\/td>\n<\/tr>\n
      ITS4<\/td>\n5′ TCCTCCGCTTATTGATATGC 3′<\/td>\n<\/tr>\n
      NL1<\/td>\n5′ GCATATCAATAAGCGGAGGAAAAG 3′<\/td>\n<\/tr>\n
      NL4<\/td>\n5′ GGTCCGTGTTTCAAGACGG 3′<\/td>\n<\/tr>\n
      \nReference of primer\n
        \n
      • White, T. J., Bruns, T., Lee, S., and Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds.), PCR Protocols: A Guide to Methods and Applications, pp. 315-322, Academic Press, New York.<\/li>\n
      • O’Donell, K. (1993). Fusarium and its near relatives, In: Reynolds, D. R. and Taylor, J. W. (eds.), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225-233, CAB International, Wallingford.<\/li>\n<\/ul>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

        <\/p>\n

        Related Website<\/h4>\n

        Related Articles<\/h4>\n","protected":false},"excerpt":{"rendered":"

        Preparation of Genomic DNA Suspend bacteria cells in 8 ml of [0.7 M NaCl, 0.1 M EDTA (pH 8.0)] in 50 ml conical tube. Add 1 ml of 10 mg\/ml lysozyme in PBS. Add 30 ul of 100 mg\/ml labiase. Incubate mix […]<\/p>\n","protected":false},"author":9,"featured_media":0,"parent":296,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"_seopress_titles_title":"","_seopress_titles_desc":"","_seopress_robots_index":"","_seopress_robots_follow":"","_seopress_robots_imageindex":"","_seopress_robots_snippet":"","_seopress_robots_primary_cat":"","_seopress_robots_breadcrumbs":"","_seopress_robots_freeze_modified_date":"","_seopress_robots_custom_modified_date":"","_seopress_robots_canonical":"","_seopress_social_fb_title":"","_seopress_social_fb_desc":"","_seopress_social_fb_img":"","_seopress_social_fb_img_attachment_id":0,"_seopress_social_fb_img_width":0,"_seopress_social_fb_img_height":0,"_seopress_social_twitter_title":"","_seopress_social_twitter_desc":"","_seopress_social_twitter_img":"","_seopress_social_twitter_img_attachment_id":0,"_seopress_social_twitter_img_width":0,"_seopress_social_twitter_img_height":0,"_seopress_redirections_value":"","_seopress_redirections_enabled":"","_seopress_redirections_enabled_regex":"","_seopress_redirections_logged_status":"","_seopress_redirections_param":"","_seopress_redirections_type":0,"_seopress_analysis_target_kw":"","footnotes":"","_wp_rev_ctl_limit":""},"class_list":["post-2415","page","type-page","status-publish","hentry"],"_links":{"self":[{"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/pages\/2415","targetHints":{"allow":["GET"]}}],"collection":[{"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/users\/9"}],"replies":[{"embeddable":true,"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/comments?post=2415"}],"version-history":[{"count":3,"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/pages\/2415\/revisions"}],"predecessor-version":[{"id":4329,"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/pages\/2415\/revisions\/4329"}],"up":[{"embeddable":true,"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/pages\/296"}],"wp:attachment":[{"href":"http:\/\/dna.brc.riken.jp\/ja\/wp-json\/wp\/v2\/media?parent=2415"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}