Resource data sheet
Prev.

B95. delta A delta fabR

Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon.

Catalog number RDB13712
Resource name B95. delta A delta fabR
Clone info. Escherichia coli BL21(DE3)-based host strain with no specific assignment of the UAG codon. Spontaneous derivative of B95. delta A.
prfA gene has been deleted. Use primers prfAnoATG: AAGCCTTCTATCGTTGCCAAAC (22 bases) and prfATAARev: TTATTCCTGCTCGGACAACG (20 bases) for checking that the 1080 bp fragment of prfA gene is not amplified.
Vector backbone Bacteria culture
Depositor Sakamoto, Kensaku |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The materials are only available based on the written approval by the depositor. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literature(s) designated by the DEPOSITOR is requested. (Mukai, T., Sci. Rep. 5: 9699 2015.) In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The materials are only available for the user belonging to a nonprofit organization.
(Japanese text [open/close])
Remarks ((Additional form)) Approval Form(FormD)
((Remarks)) Derived from BL21(DE3).
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB13712 B95. delta A delta fabR Bacteria in stub agar

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13712_A6Ehp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: B95.delta_fabR#1 ( templete 4 ) RDB13712_A6Ehc_templete4.seq
>BL21(DE3)_7_B.95delta_fabR#1_A03_03.ab1
    1 TATGCAGCAG TACTTTTGGC AGGATTCAGA CATCGTGATG GGCGTAAGAG CGCAACAAAA
   61 AGAAAAAACC CGCCGTTCGC TGGTGGAAGC CGCATTTAGC CAATTAAGTG CTGAACGCAG
  121 CTTCGCCAGC CTGAGTTTGC GTGAAGTGGC GCGTGAAGCG GGCATTGCTC CCACCTCTTT
  181 TTATCGGCAT TTCCGCGACG TAGACGAACT GGGTCTGACC ATGGTTGATG AGAGCGGTTT
  241 AATGCTACGC CAACTCATGC GCCAGGCGCG TCAGCGTATC GCCAAAGGCG GGAGTGTGAT
  301 CCGCACCTCG GTCTCCACAT TTATGGAGTT CATCGGTAAT AATCCTAACG CCTTCCGGTT
  361 ATTATTGCGG GAACGCTCCG GCACCTCCGC TGCGTTTCGT GCCGCCGTTG CGCGTGAAAT
  421 TCAGCACTTC ATTGCGGAAC TTGCGGACTA TCTGGAACTC GAAAACCATA TGCCGCGTGC
  481 GTTTACTGAA GCGCAAGCCG AAGCAATGGT GACAATTGTC TTCAGTGCGG GTGCCGAGGC
  541 GTTGGACGTC GGCGTCGAAC AACGTCGGCA ATTAGAAGAG CGACTGGTAC TGCAACTGCG
  601 AATGATTTCG AAAGGGGCTT ATTACTGGTA TCGCCGTGAA CAAGAGAAAA CCGCAATTAT
  661 TCCGGGAAAT GTGAAGGACG AGTAATGAAA CAAGCAAATC AAGATAGAGG TACGCTGCTG
721 CTGGCGTTAG TTGCTGGCTT ATCGATAAAT GGGTACTTAG A
//
Primer: B95.delta_fabR#1 ( templete 7 ) RDB13712_A6Ehc_templete7.seq
>D02650A2_A6Eh_9_B95.delta_fabR#1_C03_09.ab1
    1 TGTGCAGCAG TACTTTTGGC AGGATTCAGA CATCGTGATG GGCGTAAGAG CGCAACAAAA
   61 AGAAAAAACC CGCCGTTCGC TGGTGGAAGC CGCATTTAGC CAATTAAGTG CTGAACGCAG
  121 CTTCGCCAGC CTGAGTTTGC GTGAAGTGGC GCGTGAAGCG GGCATTGCTC CCACCTCTTT
  181 TTATCGGCAT TTCCGCGACG TAGACGAACT GGGTCTGACC ATGGTTGATG AGAGCGGTTT
  241 AATGCTACGC CAACTCATGC GCCAGGCGCG TCAGCGTATC GCCAAAGGCG GGAGTGTGTC
  301 CGCACCTCGG TCTCCACATT TATGGAGTTC ATCGGTAATA ATCCTAACGC CTTCCGGTTA
  361 TTATTGCGGG AACGCTCCGG CACCTCCGCT GCGTTTCGTG CCGCCGTTGC GCGTGAAATT
  421 CAGCACTTCA TTGCGGAACT TGCGGACTAT CTGGAACTCG AAAACCATAT GCCGCGTGCG
  481 TTTACTGAAG CGCAAGCCGA AGCAATGGTG ACAATTGTCT TCAGTGCGGG TGCCGAGGCG
  541 TTGGACGTCG GCGTCGAACA ACGTCGGCAA TTAGAAGAGC GACTGGTACT GCAACTGCGA
  601 ATGATTTCGA AAGGGGCTTA TTACTGGTAT CGCCGTGAAC AAGAGAAAAC CGCAATTATT
  661 CCGGGAAATG TGAAGGACGA GTAATGAAAC AAGCAAATCA AGATAGAGGT ACGCTGCTGC
721 TGGCGTTAGT TGCTGGCTTA TCAAAAGGGG AGTTGTCTAT T
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Featured content

Featured content Bacterial host strains (English text)
Featured content Incorporation of synthetic amino acids into proteins at specific sites (English text)
Featured content Incorporation of synthetic amino acids into proteins at specific sites (Japanese text)

References

original Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672.
reference Mukai, T., Reassignment of a rare sense codon to a non-canonical amino acid in Escherichia coli. Nucleic Acids Res. 43 (16): 8111-8122 (2015). PMID 26240376.

2017.07.10

GNP_filter3_RDBDEP_html_170505.pl