Resource data sheet
Prev.

AtPIP2;1cDNA (+stop codon)

Plasmid clone of Arabidopsis PIP2A water channel cDNA

Catalog number RDB07921
Resource name AtPIP2;1cDNA (+stop codon)
Clone info. Plasmid clone of Arabidopsis PIP2A water channel cDNA. This clone includes a stop codon.
Primers for PCR cloning: forward, 5' CACCATGGCAAAGGATGTGGAAG; reverse, 5' TTAGACGTTGGCAGCACTTCTGAATG.
[Data sheet: http://dna.brc.riken.jp/DataSheet/RDB07921]
Vector backbone pENTR/D-TOPO
Selectable markers Kan^r
Classification Plasmid
Type_of_insert fragment Arabidopsis thaliana cDNA (strain col-0)
Other clones with this gene Arabidopsis thaliana PIP2A (KEGG orthology K09872) |
Deposotor's page Maeshima, Masayoshi |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
(Japanese text [open/close])
Fee (non-profit org.)

Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.

References and tips

Electronic file

Link to old catalog RDB07921 (link to web catalog)

Featured content

Reference


2017.03.16

GNP_filter3_RDBDEP_html_170316.pl