Resource data sheet
Prev.

pGL4-phIL6

Promoter collection, Human IL6 promoter

Catalog number RDB07313
Resource name pGL4-phIL6
Alternative name U2666 (2044)-7
Clone info. Promoter collection. PCR amplified human IL6 promoter sequence was inserted into a firefly luciferase vector.
F-primer: agagctgtctgggtctctgg; R-primer: tcctggaggggagatagagc. Entire sequence of promoter region has not been confirmed.
[Data sheet: http://dna.brc.riken.jp/DataSheet/RDB07313]
Vector backbone pGL4.10 [Luc2]
Selectable markers Amp^r
Classification Plasmid
Type_of_insert fragment Human genomic DNA (WI38)
Other clones with this gene human IL6 (NCBI Gene 3569) |
Deposotor's page DNA Bank, | Pan, Jianzhi |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
(Japanese text [open/close])
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
(Japanese text [open/close])
Fee (non-profit org.)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07313_A3F6.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F RDB07313_A3F6a.seq
>07313_07313_A3F6_pGL4-4174F_G07_19.ab1
    1 AATAGGTCAG ACATTTCTCT GGCCTAACTG GCCGGTACCT GAGCTCGCTA GCCTCGAGGA
   61 TAGAGCTGTC TGGGTCTCTG GAGACTGGAG GGACAACCTA GTCTAGAGCC CATTTGCATG
  121 AGACCAAGGA TCCTCCTGCA AGAGACACCA TCCTGAGGGA AGAGGGCTTC TGAACCAGCT
  181 TGACCCAATA AGAAATTCTT GGGTGCCGAC GCGGAAGCAG ATTCAGAGCC TAGAGCCGTG
  241 CCTGCGTCCG TAGTTTCCTT CTAGCTTCTT TTGATTTCAA ATCAAGACTT ACAGGGAGAG
  301 GGAGCGATAA ACACAAACTC TGCAAGATGC CACAAGGTCC TCCTTTGACA TCCCCAACAA
  361 AGAGGTGAGT AGTATTCTCC CCCTTTCTGC CCTGAACCAA GTGGGCTTCA GTAATTTCAG
  421 GGCTCCAGGA GACCTGGGGC CCATGCAGGT GCCCCAGTGA AACAGTGGTG AAGAGACTCA
  481 GTGGCAATGG GGAGAGCACT GGCAGCACAA GGCAAACCTC TGGCACAGAG AGCAAAGTCC
  541 TCACTGGGAG GATTCCCAAG GGGTCACTTG GGAGAGGGCA GGGCAGCAGC CAACCTCCTC
  601 TAAGTGGGCT GAAGCAGGTG AAGAAAGTGG CAGAAGCCAC GCGGTGGCAA AAAGGAGTCA
  661 CACACTCCAC CTGGAGACGC CTTGAAGTAA CTGCACGAAA TTTGAGGATG GCCAGGCAGT
  721 TCTACAACAG CCGCTCACAG GGAGAGCCAG AACACAGAAG AACTCAGATG ACTGGTAGTA
  781 TTACCTTCTT CATAATCCCA GGCTTGGGGG GCTGCGATGG AGTCAGAGGA AACTCAGTTC
  841 AGAACATCTT TGGTTTTTAC AAATACAAAT TAACTGGAAC GCTAAATTCT AGCCTGTTAA
  901 TCTGGTCACT GAAAAAAAAT TTTTTTTTTT TCAAAAAACA TAGCTTTAGC TTATTTTTTT
  961 TCTCTTTGTA AAACTTCGTG CATGACTTCA GCTTTACTCT TTGTCAAGAC ATGCCCAAAG
 1021 TGCTGAGTCA CTATAAAAGA AAAAAAAAGA AAGTAAAAGA GAAGTGATCT GCTCTAGCGC
 1081 TAGCCTCATG ACCGAACTTA GCCTGCACTT TCTCTAGCTG TGTCTGCATG CTAAGGAACG
1141 TTCACATGGC ACCAATCCTT AAATAAGGAT TTTTCA
//
Primer: pGL4-136R RDB07313_A3F6b.seq
>07313_07313_A3F6_pGL4-136R_H07_22.ab1
    1 GTTTCAAAGG GTTTTTTGGC AACCTTTCCA TGGTTGGCTT TACCAACAGT AACCGGATTG
   61 CCAAGCTTGG CCGCCGAGGC CAGATCTTGA TTCCTGGAGG GGAGATAGAG CTTCTCTTTC
  121 GTTCCCGGTG GGCTCGAGGG CAGAATGAGC CTCAGACATC TCCAGTCCTA TATTTATTGG
  181 GGGTTGAGAC TCTAATATTG AGACTCATGG GAAAATCCCA CATTTGATAA ATCTTTGTTG
  241 GAGGGTGAGG GTGGGGCCAG AGCGGGTGGG GCTGATTGGA AACCTTATTA AGATTGTGCA
  301 ATGTGACGTC CTTTAGCATG GCAAGACACA ACTAGGGGGA AAAGTGCAGC TTAGGTCGTC
  361 ATTGAGGCTA GCGCTAAGAA GCAGAACCAC TCTTCCTTTA CTTTCTTTTT TTCTTTTATT
  421 AGTGACTCAG CACTTTGGCA TGTCTTGACA AAGAGTAAAG CTGAAGTCAT GCACGAAGTT
  481 TTACAAAGAG AAAAAAAATA AGCTAAAGCT ATGTTTTTTG AAAAAAAAAA AATTTTTTTT
  541 CAGTGACCAG ATTAACAGGC TAGAATTTAG CGTTCCAGTT AATTTGTATT TGTAAAAACC
  601 AAAGATGTTC TGAACTGAGT TTCCTCTGAC TCCATCGCAG CCCCCCAAGC CTGGGATTAT
  661 GAAGAAGGTA ATACTACCAG TCATCTGAGT TCTTCTGTGT TCTGGCTCTC CCTGTGAGCG
  721 GCTGTTGTAG AACTGCCTGG CCATCCTCAA ATTTCGTGCA GTTACTTCAA GGCGTCTCCA
  781 GGTGGAGTGT GTGACTCCTT TTTGCCAACC GCGTGGCTTC TGCCACTTTC TTCACCTGCT
  841 TCAGCCCACT TAGAGGAGGT TGGCTGCTGC CCTGCCCTCT CCCAAGTGAA CCCCTTGGGG
  901 AATCCTCCCA GTGAGGGACT TTTGCTCTCT GTGCCCAGAG GTTTTGCCTT TGTGCTGCCC
  961 AGTGCCTCTC CCCATTGCCC ACTGAAGTCT CTTCACCACT GTTTTCACTG GGGGCACCCT
 1021 GGCATGGGGC CCCAGGTCTC CCTGGAAGCC CTGAAAATAC TGAAGCCACT TTGGTTCAGG
 1081 GCCAGAAAAG GGGGGAGAAT ACTTACTTCA CCCTTCTTTG TGGGGAATGT TCAAAGGAGG
 1141 GAACCTTGTG CATCTTGCAA AAGTTTGGTG ATTTATATCG CTCTCCCATC CTTCCCCTCT
1201 GTATAAGTAC TCTGTGAATA TTGA
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Link to old catalog RDB07313 (link to web catalog)
Electronic file PDF RDB07313.pdf from Depositor

Featured content

Featured content EXR0043e (English text)
Featured content EXR0043j (Japanese text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

Reference

user report Zimmermann, M., Chromatin remodelling and autocrine TNF alpha are required for optimal interleukin-6 expression in activated human neutrophils. Nat. Commun. 6: 6061 (2015). PMID 25616107.

2017.03.14

GNP_filter3_RDBDEP_html_170226.pl