Resource data sheet
Prev.

pCMFlag_hsIL8

Expression vector of human IL8

Catalog number RDB07023 (link to web catalog)
Resource name pCMFlag_hsIL8
Alternative name SET-0201_7
Clone info. Expression vector of human IL8.
Derived from Sugano DMC04644. F-primer: atgacttccaagctggccgtgg; R-primer: ttatgaattctcagccctcttca.
[Data sheet: http://dna.brc.riken.jp/DataSheet/RDB07023]
Vector backbone pCMV_S-FLAG
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Classification Plasmid
Type_of_insert fragment Human cDNA ()
Other clones with this gene 3576 | (indicated in NCBI Gene ID)
Deposotor's page DNA Bank, |
Reference Jump to table (bottom).

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions for distribution The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
(In Japanese [open/close])
Fee (non-profit org.)

We examined.

Data are summerized on test sheet below.

Test sheet RDB13985_A6Cep1.pdf

Nucleotide sequence of a portion of this resource.

Primer: CMV-Forward RDB13985_A6Cea.seq
>07023_13985_A6Ce_CMV-Forward_D08_11.ab1
    1 CTTTACTCCG CCCATTGACG CAATGGGCGG TAGGCGTGTA CGGTGGGAGG TCTATATAAG
   61 CAGAGCTCTC TGGCTAACTA GAGAACCCAC TGCTTACTGG CTTATCGAAA TTAATACGAC
  121 TCACTATAGG GAGACCCAAG CTGAATTCAC CATGGACTAC AAGGACGATG ACGATAAGGC
  181 GGCCATGACT TCCAAGCTGG CCGTGGCTCT CTTGGCAGCC TTCCTGATTT CTGCAGCTCT
  241 GTGTGAAGGT GCAGTTTTGC CAAGGAGTGC TAAAGAACTT AGATGTCAGT GCATAAAGAC
  301 ATACTCCAAA CCTTTCCACC CCAAATTTAT CAAAGAACTG AGAGTGATTG AGAGTGGACC
  361 ACACTGCGCC AACACAGAAA TTATTGTAAA GCTTTCTGAT GGAAGAGAGC TCTGTCTGGA
  421 CCCCAAGGAA AACTGGGTGC AGAGGGTTGT GGAGAAGTTT TTGAAGAGGG CTGAGAATTC
  481 ATAAGGCCGC TCGAGCATGC ATCTAGAGGG CCCTATTCTA TAGTGTCACC TAAATGCTAG
  541 AGCTCGCTGA TCAGCCTCGA CTGTGCCTTC TAGTTGCCAG CCATCTGTTG TTTGCCCCTC
  601 CCCCGTGCCT TCCTTGACCC TGGAAGGTGC CACTCCCACT GTCCTTTCCT AATAAAATGA
  661 GGAAATTGCA TCGCATTGTC TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA
  721 GGACAGCAAG GGGGAGGATT GGGAAGACAA TAGCAGGCAT GCTGGGGATG CGGTGGGCTC
  781 TATGGCTTCT GAGGCGGAAG AACCAGCTGG GGCTCGAGGG GGGATCCCCA CGCGCCCTGT
  841 AGCGGCGCAT TAAGCGCGGC GGGTGTGGTG GTTACGCGCA GCGTGACCGC TACACTTGCC
  901 AGCGCCCTAG CGCCCGCTCC TTTCGCTTTC TTCCCTTCCT TTCTCGCCAC GTTCGCCGGC
  961 TTTCCCCGTC AAGCTCTAAA TCGGGGGGGC TCCCTTTAGG TTCCGATTTA GTGCTTTACG
 1021 GCACCCTCGA CCCCCCAAAA AACTTGGATT ATGTGATGGA TCACGGTTAG TTGCGCCAAT
1081 CGACCATGGC ATTAGGAACG ATTTTCGATC GTTTGAACCG AATTTTG
//
Primer: SV40pro_F_V2 RDB13985_A6Ceb.seq
>07023_13985_A6Ce_SV40pro_F_V2_E08_14.ab1
    1 TGGACTTTTT GGAGCTAGGC TTTTGCAAAA GCTCCCGGGA GCTTGGATAT CCATTTTCGG
   61 ATCTGATCAA GAGACAGGAT GAGGATCGTT TCGCATGATT GAACAAGATG GATTGCACGC
  121 AGGTTCTCCG GCCGCTTGGG TGGAGAGGCT ATTCGGCTAT GACTGGGCAC AACAGACAAT
  181 CGGCTGCTCT GATGCCGCCG TGTTCCGGCT GTCAGCGCAG GGGCGCCCGG TTCTTTTTGT
  241 CAAGACCGAC CTGTCCGGTG CCCTGAATGA ACTGCAGGAC GAGGCAGCGC GGCTATCGTG
  301 GCTGGCCACG ACGGGCGTTC CTTGCGCAGC TGTGCTCGAC GTTGTCACTG AAGCGGGAAG
  361 GGACTGGCTG CTATTGGGCG AAGTGCCGGG GCAGGATCTC CTGTCATCTC ACCTTGCTCC
  421 TGCCGAGAAA GTATCCATCA TGGCTGATGC AATGCGGCGG CTGCATACGC TTGATCCGGC
  481 TACCTGCCCA TTCGACCACC AAGCGAAACA TCGCATCGAG CGAGCACGTA CTCGGATGGA
  541 AGCCGGTCTT GTCGATCAGG ATGATCTGGA CGAAGAGCAT CAGGGGCTCG CGCCAGCCGA
  601 ACTGTTCGCC AGGCTCAAGG CGCGCATGCC CGACGGCGAG GATCTCGTCG TGACCCATGG
  661 CGATGCCTGC TTGCCGAATA TCATGGTGGA AAATGGCCGC TTTTCTGGAT TCATCGACTG
  721 TGGCCGGCTG GGTGTGGCGG ACCGCTATCA GACATAGCGT TGGCTACCCG TGATATTGCT
  781 GAAGAGCTTG GCGGCGAATG GGCTGACCGC TTTCTCGTGC TTTACGGTAT CGCCGCTCCC
  841 GATTCGCAGC GCATCGCCTT CTATCGCCTT CTTGACGAGT CTCTGAGCGG GACTCTGGGG
  901 TTCGAATGAC GACAGCGACG CCCACTGCAT CACGAGATTT CGATCCACCG CCGCCTTCTA
  961 TGGAAAGTGG CTCGATCGTT CCGAACGCCG CTGATGATCT TCAGCCGGGG AATTCCATGC
1021 TGAATCATCG CCATCCAACT GGTAATC
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips


2016.10.06

GNP_filter3_RDBDEP_html_160913.pl