Resource data sheet


Expression vector of human IL6

Catalog number RDB06998 (link to web catalog)
Resource name pCMFlag_hsIL6
Alternative name SET-0199_12-1
Clone info. Expression vector of human IL6.
Derived from Sugano CAS04362. F-primer: atgaactccttctccacaagc; R-primer: ctacatttgccgaagagccctc.
[Data sheet:]
Vector backbone pCMV_S-FLAG
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Classification Plasmid
Type_of_insert fragment Human cDNA ()
Other clones with this gene 3569 | (indicated in NCBI Gene ID)
Deposotor's page DNA Bank, |
Reference Jump to table (bottom).

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions for distribution The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
(In Japanese [open/close])
Fee (non-profit org.)

We examined.

Data are summerized on test sheet below.

Test sheet RDB12822_A4Ggp1.pdf

Nucleotide sequence of a portion of this resource.

Primer: CMV-Forward RDB12822_A4Gga_2.seq
Primer: SV40pro_F_V2 RDB12822_A4Ggb_2.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file PDF RDB06998.pdf from Depositor
Featured content pCMV_tag and pRSV_tag assay-ready clones (in English)
