Resource data sheet


Expression vector of human GATA1

Catalog number RDB06753 (link to web catalog)
Resource name pCMFlag_hsGATA1
Alternative name SET-0120_1
Clone info. Expression vector of human GATA1. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: gagttccctggcctggggtc; R-primer: tcatgagctgagcggagccac.
[Data sheet:]
Vector backbone pCMV_S-FLAG
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Classification Plasmid
Type_of_insert fragment Human cDNA (K562)
Other clones with this gene 2623 | (indicated in NCBI Gene ID)
Deposotor's page DNA Bank, |
Reference Jump to table (bottom).

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions for distribution The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
(In Japanese [open/close])
Fee (non-profit org.)

We examined.

Data are summerized on test sheet below.

Test sheet RDB13039_A6Cep1.pdf

Nucleotide sequence of a portion of this resource.

Primer: CMV-Forward RDB13039_A6Cea.seq
Primer: BGH_rev RDB13039_A6Ceb.seq
Primer: SV40pro_F_V2 RDB13039_A6Cec.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file PDF RDB06753.pdf from Depositor
Featured content pCMV_tag and pRSV_tag assay-ready clones (in English)
user report - reference Nishino, T., Antagonizing effect of CLPABP on the function of HuR as a regulator of ARE-containing leptin mRNA stability and the effect of its depletion on obesity in old male mouse. Biochim Biophys Acta. 2016 Sep 9. pii: S1388-1981(16)30243-8. doi: 10.1016/j.bbalip.2016.09.006. [Epub ahead of print] PMID 27616329.
