Resource data sheet
Prev.

pCMFlag_hsGATA1

Expression vector of human GATA1

Catalog number RDB06753
Resource name pCMFlag_hsGATA1
Alternative name SET-0120_1
Clone info. Expression vector of human GATA1. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: gagttccctggcctggggtc; R-primer: tcatgagctgagcggagccac.
[Data sheet: http://dna.brc.riken.jp/DataSheet/RDB06753]
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human GATA1 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human GATA1 (NCBI Gene 2623) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06753 pCMFlag_hsGATA1 DNA solution

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13039_A6Cep1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB13039_A6Cea.seq
>06753_13039_A6Ce_CMV-Forward_A08_02.ab1
    1 TTTTCACGCC GCGCGGATTG ACGCAGATGG GCGGTAGGCG TGTACGGTGG GAGGTCTATA
   61 TAAGCAGAGC TCTCTGGCTA ACTAGAGAAC CCACTGCTTA CTGGCTTATC GAAATTAATA
  121 CGACTCACTA TAGGGAGACC CAAGCTGAAT TCACCATGGA CTACAAGGAC GATGACGATA
  181 AGGCGGCCGA GTTCCCTGGC CTGGGGTCCC TGGGGACCTC AGAGCCCCTC CCCCAGTTTG
  241 TGGATCCTGC TCTGGTGTCC TCCACACCAG AATCAGGGGT TTTCTTCCCC TCTGGGCCTG
  301 AGGGCTTGGA TGCAGCAGCT TCCTCCACTG CCCCGAGCAC AGCCACCGCT GCAGCTGCGG
  361 CACTGGCCTA CTACAGGGAC GCTGAGGCCT ACAGACACTC CCCAGTCTTT CAGGTGTACC
  421 CATTGCTCAA CTGTATGGAG GGGATCCCAG GGGGCTCACC ATATGCCGGC TGGGCCTACG
  481 GCAAGACGGG GCTCTACCCT GCCTCAACTG TGTGTCCCAC CCGCGAGGAC TCTCCTCCCC
  541 AGGCCGTGGA AGATCTGGAT GGAAAAGGCA GCACCAGCTT CCTGGAGACT TTGAAGACAG
  601 AGCGGCTGAG CCCAGACCTC CTGACCCTGG GACCTGCACT GCCTTCATCA CTCCCTGTCC
  661 CCAATAGTGC TTATGGGGGC CCTGACTTTT CCAGTACCTT CTTTTCTCCC ACCGGGAGCC
  721 CCCTCAATTC AGCAGCCTAT TCCTCTCCCA AGCTTCGTGG AACTCTCCCC CTGCCTCCCT
  781 GTGAGGCCAG GGAGTGTGTG AACTGCGGAG CAACAGCCAC TCCACTGTGG CGGAGGGACA
  841 GGACAGGCCA CTACCTATGC AACGCCTGCG GCCTCTATCA CAAGATGAAT GGGCAGAACA
  901 GGCCCCTTCA TCCGGCCCAA GAAGCGCCTG ATTGTCAGTA AACGGGCAAG GTACTTCAGT
  961 GCACCCAACT GCCCAGACGA CCACCCACGA CACTGTGGCG GAGAAAATGC CCAGTGGGGA
 1021 TCCCGTGTGC AAATGCCCTT GCGGCCTCCT ACCTACTAGC CTACACCAAG TGAACTGGCA
1081 CTGAACATGC GAAGGAATGG TATTCGACTC GAACCGGCTG AAG
//
Primer: BGH_rev RDB13039_A6Ceb.seq
>06753_13039_A6Ce_BGHrev_B08_05.ab1
    1 GACCTGACAT TTAGGTGACC TATAGAATAG GGCCCTCTAG ATGCATGCTC GAGCGGCCTC
   61 ATGAGCTGAG CGGAGCCACC ACAGTAGTGC TGGTGGTGGG GGGCATGGGG CCTGTGGGGA
  121 AGGAGCCCGT GGGTGAGCCC AGTAGGGGTC CAGGGAAAGG CATGAGGTGG CTAACAGGCC
  181 CTGACAGCAC CACAGGGCCC AGGCCTTGGT AGAGATGGGC AGTACCTGGG GGGCCCAGTG
  241 TCAGGCCTGA AGCCACCTCC CCACAATTCC CGCTACCGCT GCCCCCAGCC ACCACCATAA
  301 AGCCACCAGC TGGTCCTTCG GCTGCTCCTG TGCCTCCCAG ACTGGAGCCC CGTTTCTTTT
  361 TCCCTTTTCC AGATGCCTTG CGGTTTCGAG TCTGAATACC ATCCTTCCGC ATGGTCAGTG
  421 GCCGGTTCAC CTGGTGTAGC TTGTAGTAGA GGCCGCAGGC ATTGCACACG GGATCCCCAC
  481 TGGCATTTCT CCGCCACAGT GTCGTGGTGG TCGTCTGGCA GTTGGTGCAC TGAGTACCTG
  541 CCCGTTTACT GACAATCAGG CGCTTCTTGG GCCGGATGAG GGGCCTGTTC TGCCCATTCA
  601 TCTTGTGATA GAGGCCGCAG GCGTTGCATA GGTAGTGGCC TGTCCTGTCC CTCCGCCACA
  661 GTGGAGTGGC TGTTGCTCCG CAGTTCACAC ACTCCCTGGC CTCACAGGGA GGCAGGGGGA
  721 GAGTTCCACG AAGCTTGGGA GAGGAATAGG CTGCTGAATT GAGGGGGCTC CCGGTGGGAG
  781 AAAAGAAGGT ACTGGAAAAG TCAGGGCCCC CATAAGCACT ATTGGGGACA GGGAGTGATG
  841 AAGGCAGTGC AGGTCCCAGG GTCAGGAGGT CTGGGCTCAG CCGCTCTGTC TTCAAAGTCT
  901 CCAGGAAGCT GGTGCTGCCT TTTCCATCCA GATCTTCCAC GGGCCTGGGG AGGGAGAGTC
  961 CTCGCGGGTG GGACACACAG TTTGAGGCAG GGTAGAGCCC CCGTCTTGCC CGTAGGCCCA
 1021 GCCGGCATAT GGTTGAGCCC TCCTGGGATC CCGTCATACA GTTTGGAGCC AATGGTACAT
1081 CTTGAAGGAA CTGGGGAAGT GTTCTGTGTA AGGGTCT
//
Primer: SV40pro_F_V2 RDB13039_A6Cec.seq
>06753_13039_A6Ce_SV40pro_F_V2_C08_08.ab1
    1 CTGGGCGCTT TTTTTTGGGA GGCCTAGGCT TTTGCAAAAA GCTCCCGGGA GCTTGGATAA
   61 TCCAATTTTC GGATCTGATC AAGAGACAGG ATGAGGATCG TTTCGCATGA TTGAACAAGA
  121 TGGATTGCAC GCAGGTTCTC CGGCCGCTTG GGTGGAGAGG CTATTCGGCT ATGACTGGGC
  181 ACAACAGACA ATCGGCTGCT CTGATGCCGC CGTGTTCCGG CTGTCAGCGC AGGGGCGCCC
  241 GGTTCTTTTT GTCAAGACCG ACCTGTCCGG TGCCCTGAAT GAACTGCAGG ACGAGGCAGC
  301 GCGGCTATCG TGGCTGGCCA CGACGGGCGT TCCTTGCGCA GCTGTGCTCG ACGTTGTCAC
  361 TGAAGCGGGA AGGGACTGGC TGCTATTGGG CGAAGTGCCG GGGCAGGATC TCCTGTCATC
  421 TCACCTTGCT CCTGCCGAGA AAGTATCCAT CATGGCTGAT GCAATGCGGC GGCTGCATAC
  481 GCTTGATCCG GCTACCTGCC CATTCGACCA CCAAGCGAAA CATCGCATCG AGCGAGCACG
  541 TACTCGGATG GAAGCCGGTC TTGTCGATCA GGATGATCTG GACGAAGAGC ATCAGGGGCT
  601 CGCGCCAGCC GAACTGTTCG CCAGGCTCAA GGCGCGCATG CCCGACGGCG AGGATCTCGT
  661 CGTGACCCAT GGCGATGCCT GCTTGCCGAA TATCATGGTG GAAAATGGCC GCTTTTCTGG
  721 ATTCATCGAC TGTGGCCGGG CTGGGTGTGG CGGACCGCTA TCAGGACATA GCGTTGGCTA
  781 CCCGTGATAT TGCTGAAGAG CTTGGCGGCG AAATGGGCTG ACCGCTTCCT CGTGCTTTAC
  841 GGTATCGCCG CTCCCCGATT CGCAGCGCAT CGCCTTCTAT CGCCTTCTTG ACGAAGTTCT
  901 TCTGAAGCGG GACTCTGGGG GTTCGAAATG ACCGACCAAG CCGAACGCCC CAACCCTGCC
  961 CATCACGAAG ATTTCGGAAT TCCCACCGCC CGCCCTTCTA TGGAAAGGTT TGGGGCTTTC
 1021 GGGAAATTCG TTTTTTCCCG GGGAACGGCC GGCTTGGGAA TGAGATCCCC TCCAGCGGCC
 1081 GGGGGAATTC TCAATGGCTT GGGAAGGTTC TTTCGTCGAC CTGAAACCTT TGATTTAATT
1141 GCCAAGCCTT ATTAAACTTG GGCGTTTA
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Link to old catalog RDB06753 (link)
Electronic file PDF RDB06753.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Reference

user report Nishino, T., Antagonizing effect of CLPABP on the function of HuR as a regulator of ARE-containing leptin mRNA stability and the effect of its depletion on obesity in old male mouse. Biochim. Biophys. Acta. 2016 Sep 9. pii: S1388-1981(16)30243-8. doi: 10.1016/j.bbalip.2016.09.006. [Epub ahead of print] PMID 27616329.

2017.05.15

GNP_filter3_RDBDEP_html_170505.pl