Resource data sheet
Prev.

pCMFlag_hsLIN28

Expression vector of human LIN28

Catalog number RDB06602 (link to web catalog)
Resource name pCMFlag_hsLIN28
Alternative name SET-0226_1
Clone info. Expression vector of human LIN28. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: ggctccgtgtccaaccagcagtt; R-primer: tcaattctgtgcctccgggagca iPS Yamanaka factor.
[Data sheet: http://dna.brc.riken.jp/DataSheet/RDB06602]
Vector backbone pCMV_S-FLAG
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Classification Plasmid
Type_of_insert fragment Human cDNA (khES-1)
Other clones with this gene 79727 | (indicated in NCBI Gene ID)
Deposotor's page DNA Bank
Reference Jump to table (bottom).

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions for distribution 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
(In Japanese [open/close])
Fee (non-profit org.)

This clone will be sequenced a portion and digested by restriction enzyme for verification.

References and tips

Electronic file PDF RDB06602.pdf from Depositor
Featured content EXR0039e (in English)
Featured content EXR0039j (in Japanese)
Featured content pCMV_tag and pRSV_tag assay-ready clones (in English)
user report - reference Hayashi, S., Lin28a is a putative factor in regulating cancer stem cell-like properties in side population cells of oral squamous cell carcinoma. Exp Cell Res. 2013 May 1;319(8):1220-8. PMID 23500413.

2016.07.26

GNP_filter3_RDBDEP_html_160610.pl