Resource data sheet
Prev.

pCMFlag_hsJUN

Expression vector of human JUN

Catalog number RDB06254
Resource name pCMFlag_hsJUN
Alternative name SET-0010_37
Clone info. Expression vector of human JUN. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: atgactgcaaagatggaaacg; R-primer: tcaaaatgtttgcaactgctg.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human c-jun cDNA
Depositor DNA Bank, |
 
Other clones in our bank human JUN (NCBI Gene 3725) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06254 pCMFlag_hsJUN DNA solution

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB08129_A4L8p1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB08129_A4L8a.seq
>06254_08129_A4L8_CMV-Forward_A10_01.ab1
    1 TGTCACTCCG CCCCATTGAC GCAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA
   61 GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA
  121 CTCACTATAG GGAGACCCAA GCTGAATTCA CCATGGACTA CAAGGACGAT GACGATAAGG
  181 CGGCCATGAC TGCAAAGATG GAAACGACCT TCTATGACGA TGCCCTCAAC GCCTCGTTCC
  241 TCCCGTCCGA GAGCGGACCT TATGGCTACA GTAACCCCAA GATCCTGAAA CAGAGCATGA
  301 CCCTGAACCT GGCCGACCCA GTGGGGAGCC TGAAGCCGCA CCTCCGCGCC AAGAACTCGG
  361 ACCTCCTCAC CTCGCCCGAC GTGGGGCTGC TCAAGCTGGC GTCGCCCGAG CTGGAGCGCC
  421 TGATAATCCA GTCCAGCAAC GGGCACATCA CCACCACGCC GACCCCCACC CAGTTCCTGT
  481 GCCCCAAGAA CGTGACAGAT GAGCAGGAGG GCTTCGCCGA GGGCTTCGTG CGCGCCCTGG
  541 CCGAACTGCA CAGCCAGAAC ACGCTGCCCA GCGTCACGTC GGCGGCGCAG CCGGTCAACG
  601 GGGCAGGCAT GGTGGCTCCC GCGGTAGCCT CGGTGGCAGG GGGCAGCGGC AGCGGCGGCT
  661 TCAGCGCCAG CCTGCACAGC GAGCCGCCGG TCTACGCAAA CCTCAGCAAC TTCAACCCAG
  721 GCGCGCTGAG CAGCGGCGGC GGGGCGCCCT CCTACGGCGC GGCCGGCCTG GCCTTTCCCG
  781 CGCAACCCCA GCAGCAGCAG CAGCCGCCGC ACCACCTGCC CCAGCAGATG CCCGTGCAGC
  841 ACCCGCGGCT GCAGGCCCTG AAGGAGGAGC CTCAGACAGT GCCCGAGATG CCCGGCGAGA
  901 CACCGCCCCT GTCCCCCATC GACATGGAGT CCCAGGAGCG GATCAAGGCG GAGAGGAAGC
  961 GCATGAGGAA CCGCATCGCT GCCTCCAAGT GCCGAAAAAG GAAGCTGGAG AGAATCGCCC
 1021 GGGCTGGGAG GAAAAAAGTG AAAACCTTTG AAAGCTCAGA ACTCGGGAGC TGGCGTCACG
 1081 TCAACATGCT CAGGACAGTT GCACAGCTAA ACAGAAAGGT CATGAACCAC CGATTAAACA
1141 AGGTGGGGGT GTC
//
Primer: BGH_rev RDB08129_A4L8b.seq
>06254_08129_A4L8_BGHrev_B10_04.ab1
    1 GCCCTGGCAT TTAGGTGACC TATAGAATAG GGCCCTCTAG ATGCATGCTC GAGCGGCCTC
   61 AAAATGTTTG CAACTGCTGC GTTAGCATGA GTTGGCACCC ACTGTTAACG TGGTTCATGA
  121 CTTTCTGTTT AAGCTGTGCC ACCTGTTCCC TGAGCATGTT GGCCGTGGAC GCCAGCTCCG
  181 AGTTCTGAGC TTTCAAGGTT TTCACTTTTT CCTCCAGCCG GGCGATTCTC TCCAGCTTCC
  241 TTTTTCGGCA CTTGGAGGCA GCGATGCGGT TCCTCATGCG CTTCCTCTCC GCCTTGATCC
  301 GCTCCTGGGA CTCCATGTCG ATGGGGGACA GGGGCGGTGT CTCGCCGGGC ATCTCGGGCA
  361 CTGTCTGAGG CTCCTCCTTC AGGGCCTGCA GCCGCGGGTG CTGCACGGGC ATCTGCTGGG
  421 GCAGGTGGTG CGGCGGCTGC TGCTGCTGCT GGGGTTGCGC GGGAAAGGCC AGGCCGGCCG
  481 CGCCGTAGGA GGGCGCCCCG CCGCCGCTGC TCAGCGCGCC TGGGTTGAAG TTGCTGAGGT
  541 TTGCGTAGAC CGGCGGCTCG CTGTGCAGGC TGGCGCTGAA GCCGCCGCTG CCGCTGCCCC
  601 CTGCCACCGA GGCTACCGCG GGAGCCACCA TGCCTGCCCC GTTGACCGGC TGCGCCGCCG
  661 ACGTGACGCT GGGCAGCGTG TTCTGGCTGT GCAGTTCGGC CAGGGCGCGC ACGAAGCCCT
  721 CGGCGAAGCC CTCCTGCTCA TCTGTCACGT TCTTGGGGCA CAGGAACTGG GTGGGGGTCG
  781 GCGTGGTGGT GATGTGCCCG TTGCTGGACT GGATTATCAG GCGCTCCAGC TCGGGCGACG
  841 CCAGCTTGAG CAGCCCCACG TCGGGCGAGG TGAGGAGGTC CGAGTTCTTG GCGCGGAGGT
  901 GCGGCTTCAG GCTCCCCACT GGGTCGGCCA GGTTCAGGGT CATGCTCTGT TTCAGGATCT
  961 TGGGGTTACT GTAGCCATAA AGTCCGCTCT CGGACGGGAG GAACGAGGCG TTGAGGGCAT
 1021 CGTCATAGAA GGTCGTTTCC ATCTTTGCAG TCATGGCCGC CTTATCGTCA TCGTCCAGTA
 1081 GTCCATGGTT GAATCAGCTT GGGATCTCCT ATAGTGAAGT CGTATGATTT CGATAGCCAG
1141 TTAAGCCAGT GGGGTCTC
//
Primer: SV40pro_F_V2 RDB08129_A4L8c.seq
>06254_08129_A4L8_SV40pro_F_V2_C10_07.ab1
    1 GGCCAGCTTT TTTGGAGGCT AGGCTTTTGC AAAAGCTCCC GGGAGCTTGG ATATCCATTT
   61 TCGGATCTGA TCAAGAGACA GGATGAGGAT CGTTTCGCAT GATTGAACAA GATGGATTGC
  121 ACGCAGGTTC TCCGGCCGCT TGGGTGGAGA GGCTATTCGG CTATGACTGG GCACAACAGA
  181 CAATCGGCTG CTCTGATGCC GCCGTGTTCC GGCTGTCAGC GCAGGGGCGC CCGGTTCTTT
  241 TTGTCAAGAC CGACCTGTCC GGTGCCCTGA ATGAACTGCA GGACGAGGCA GCGCGGCTAT
  301 CGTGGCTGGC CACGACGGGC GTTCCTTGCG CAGCTGTGCT CGACGTTGTC ACTGAAGCGG
  361 GAAGGGACTG GCTGCTATTG GGCGAAGTGC CGGGGCAGGA TCTCCTGTCA TCTCACCTTG
  421 CTCCTGCCGA GAAAGTATCC ATCATGGCTG ATGCAATGCG GCGGCTGCAT ACGCTTGATC
  481 CGGCTACCTG CCCATTCGAC CACCAAGCGA AACATCGCAT CGAGCGAGCA CGTACTCGGA
  541 TGGAAGCCGG TCTTGTCGAT CAGGATGATC TGGACGAAGA GCATCAGGGG CTCGCGCCAG
  601 CCGAACTGTT CGCCAGGCTC AAGGCGCGCA TGCCCGACGG CGAGGATCTC GTCGTGACCC
  661 ATGGCGATGC CTGCTTGCCG AATATCATGG TGGAAAATGG CCGCTTTTCT GGATTCATCG
  721 ACTGTGGCCG GCTGGGTGTG GCGGACCGCT ATCAGGACAT AGCGTTGGCT ACCCGTGATA
  781 TTGCTGAAGA GCTTGGCGGC GAATGGGCTG ACCGCTTCCT CGTGCTTTAC GGTATCGCCG
  841 CTCCCGATTC GCAGCGCATC GCCTTCTATC GCCTTCTTGA CGAGTTCTTC TGAGCGGGAC
  901 TCTGGGGTTC GAAATGACCG ACCAAGCGAC GCCCAACCTG CCATCACGAG ATTTCGATTC
  961 CACCGCCGCC CTTCTATGAA AGGTTGGGCT TCGGAATCGT TTTCCCGGGA CGCCGGCTGG
 1021 GATGATCCTC CAGCGCGGGG ATCTCATGCT GGAGTTCTTC GCCCACCCCC AACTTGTTAT
 1081 GCAGCTATAT GGTACAATGA GCAATAGCAT CACAACTTCA CAAATTAAGC AATTTTTTTT
1141 CAACTGCCAG TTTCTAAGTG G
//

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Link to old catalog RDB06254 (link)
Electronic file PDF RDB06254.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

References


2017.08.30

GNP_filter3_RDBDEP_html_170829.pl