Resource data sheet


Expression vector of human JUN

Catalog number RDB06254
Resource name pCMFlag_hsJUN
Alternative name SET-0010_37
Clone info. Expression vector of human JUN. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: atgactgcaaagatggaaacg; R-primer: tcaaaatgtttgcaactgctg.
[Data sheet:]
Vector backbone pCMV_S-FLAG
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Classification Plasmid
Type_of_insert fragment Human cDNA (HeLa cells)
Other clones with this gene human JUN 3725 | (indicated in NCBI Gene ID)
Deposotor's page DNA Bank, |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
(Japanese text [open/close])
Fee (non-profit org.)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB08129_A4L8p1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB08129_A4L8a.seq
Primer: BGH_rev RDB08129_A4L8b.seq
Primer: SV40pro_F_V2 RDB08129_A4L8c.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Link to old catalog RDB06254 (link to web catalog)
Electronic file PDF RDB06254.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

