BioResource Center RIKEN BRC DNA BANK
  Home   Clone set   Gene Expression   Gene Analysis   Search   Literature
  Lab Manual (ja)   Lab Manual (en)   Supplemental Data

Supplemental Data

Sequencing & PCR primers

  Information (ja)   Information (en)   List of Vectors   Reference of Materials   Sequencing & PCR primers

Please contact DNA Bank dnabank@brc.riken.jp for any commnets.
Thank you.

List of Sequencing Primers

Name of Primer Sequence Vector Purpose
T7long5'-CGCCAAGCTCTAATACGACTCACTATAGGG-3'T7 promoter sequence containing vectors 
T75'-TAATACGACTCACTATAGGG -3'pCMV_S-FLAG (RDB 5956)Sequencing 5' of inserted DNA
SP65'-ATTTAGGTGACACTATAG -3'pCMV_S-FLAG (RDB 5956)Sequencing 3' of inserted DNA
pAxCAF15'-GGCTTCTGGCGTGTGACCGGC-3'CAG promoter containing vectorsSequencing 5' of inserted DNA
pAxCAR15'-CAGAGGGAAAAAGATCTCAGTGG-3'CAG promoter containing vectorsSequencing 3' of inserted DNA
pAxCALNLF15'-CACTGCATTCTAGTTGTGGTTTGTCC-3'LNL (loxP) containing vectorsSequencing 5' of inserted DNA
M135'-GTTTTCCCAGTCACGACGTTGTA-3'pKM2L luciferase vectorSequencing 5' of inserted DNA
phRLR25'-CCAATAGGTGCCTATCAGAAACGC-3'pKM2L luciferase vectorSequencing 3' of inserted DNA
7723km F5'-AATTTCTGGAATGGGGTTCA-3'Tth Disruption PlasmidKm toward insert
7723km R5'-GATTGCGATGCTGATTCGT-3'Tth Disruption PlasmidKm toward insert
BGHrev5'- TAGAAGGCACAGTCGAGG -3'BGHpA containing vectorSequencing 3' of inserted DNA
pOTB7_F(7-32)5'- AACGCGGCTACAATTAATACATAACC -3'pOTB7Sequencing 5' of inserted DNA
pOTB7_R(358-335)5'- GTACTGCAGCCGATTCATTAATGC -3'pOTB7Sequencing 3' of inserted DNA
pUAST3'5'- AACCAAGTAAATCAACTGC -3'pUASTSequencing 5' of inserted DNA
SV40-3'UTR5'- ATCTCTGTAGGTAGTTTGTC -3'pUASTSequencing 3' of inserted DNA
ME-720Fw5'- CCGGATCCGGTGGTGCAAATC -3'pME18SSequencing 5' of inserted DNA
ME-735Fw5'- GGATGTTGCCTTTACTTCTA -3'pME18SSequencing 5' of inserted DNA
ME-1290Rv5'- ATAAGCTGCAATAAACAAGTTAACAAC -3'pME18SSequencing 3' of inserted DNA
ME-1250Rv5'- TGTGGGAGGTTTTTTCTCTA -3'pME18SSequencing 3' of inserted DNA
pGCAP_F5'- CTCAGTGGATGTTGCCTTTAC -3'pGCAP1, pGCAP10Sequencing 5' of inserted DNA
pGCAP_R5'- GCATTCTAGTTGTGGTTTGTCC -3'pGCAP1, pGCAP10Sequencing 3' of inserted DNA
pMFG_F5'- CTTCTCTAGGCGCCCATATG -3'pMFGSequencing 5' of inserted DNA
pMFG_R5'- GCCTGGACCACTGATATCCT -3'pMFGSequencing 3' of inserted DNA

Related Information

PCR Primers for Detection of Adenovirul Vector

List of STS Markers for Detection of Virus Genes


go to Head

2011.01.12