BioResource Center RIKEN BRC DNA BANK
  Home   Clone set   Gene Expression   Gene Analysis   Search   Literature

Promoter Collection

  Outline   Luciferase Analyzed   Sort by Gene   Sort by Pathway   Control Vector       Binding Element
  Firefly Luc   Renilla Luc

Firefly Luciferase Constructfirefly

List of Construct

The Promoter series were validated by restriction enzyme digestion and confirmation of end sequences of insert DNA.

Sequencing Primer
pGL4-4174F: TAGCAAAATAGGCTGTCCCC
pGL4-136R: CTTCGAGTGGGTAGAATGGC

'Activity' indicates a value of the fold induction compared with empty vector.
-, less than 2
+, 2 to 5
++, 5 to 10
actual value, more than 10

Locus symbol Catalog No. Name of clone Gene of insert Other Aliases Size of PCR amplified DNA Activity in pdf
HeLa HepG2 Hep3B
  pGL3 ControlpGL3 Control Vector (SV40 promoter)  372.4159.9226.6 
ABCA1RDB07680pGL4-phABCA1Promoter collection, Human ABCA1 promoterTGD; ABC1; CERP; ABC-1; HDLDT1; FLJ14958; MGC164864; MGC1650111,154 bp63.5 51.0 11.3 PDF
ABCB1RDB07315pGL4-phABCB1Promoter collection, Human ABCB1 promoterCLCS; MDR1; P-GP; PGY1; ABC20; CD243; GP170; MGC1632961,219 bp--+PDF
ADMRDB07808pGL4-phADMPromoter collection, Human ADM promoterAM1,477 bp588.5 55.5 50.2 PDF
ADRB2RDB07532pGL4-phADRB2Promoter collection, Human ADRB2 promoterBAR; B2AR; ADRBR; ADRB2R; BETA2AR1,446 bp161.0 119.0 21.5 PDF
AGTRDB07683pGL4-phAGTPromoter collection, Human AGT promoterANHU; FLJ92595; FLJ97926; SERPINA81,494 bp---PDF
AHRRDB07724pGL4-phAHRPromoter collection, Human AHR promoterbHLHe761,460 bp225.3 67.8 49.6 PDF
AIFM2RDB07332pGL4-phAIFM2Promoter collection, Human AIFM2 promoterAMID; PRG3; RP11-367H5.21,278 bp105.0 268.0 177.0 PDF
AKT1RDB07331pGL4-phAKT1Promoter collection, Human AKT1 promoterAKT; PKB; RAC; PRKBA; MGC99656; PKB-ALPHA; RAC-ALPHA1,152 bp-++PDF
ALBRDB07818pGL4-phALBPromoter collection, Human ALB promoterPRO0883; PRO0903; PRO1341; DKFZp779N19351,471 bp+-+PDF
ALDOARDB07512pGL4-phALDOAPromoter collection, Human ALDOA promoterALDA; GSD12; MGC10942; MGC17716; MGC177671,232 bp15.5 80.4 13.7 PDF
ANTXR1RDB07333pGL4-phANTXR1Promoter collection, Human ANTXR1 promoterATR; TEM8; FLJ10601; FLJ11298; FLJ217761,189 bp88.5 30.0 36.0 PDF
APAF1RDB07316pGL4-phAPAF1Promoter collection, Human APAF1 promoterCED4; APAF-1; DKFZp781B11451,152 bp31.0 101.0 43.0 PDF
APCSRDB07317pGL4-phAPCSPromoter collection, Human APCS promoterSAP; PTX2; MGC881591,163 bp+++PDF
APEX1RDB07729pGL4-phAPEX1Promoter collection, Human APEX1 promoterAPE; APX; APE1; APEN; APEX; HAP1; REF11,460 bp216.5 99.0 67.8 PDF
APOA1RDB07684pGL4-phAPOA1Promoter collection, Human APOA1 promoterMGC1173991,485 bp++144.0 +PDF
APOBRDB07527pGL4-phAPOBPromoter collection, Human APOB promoterFLDB; LDLCQ41,436 bp-14.5 +PDF
APOC3RDB07303pGL4-phAPOC3Promoter collection, Human APOC3 promoterAPOCIII; MGC150353985 bp+158.0 33.0 PDF
APOERDB07556pGL4-phAPOEPromoter collection, Human APOE promoterAD2; LPG; LDLCQ5; MGC15711,449 bp88.3 ++++PDF
APPRDB07692pGL4-phAPPPromoter collection, Human APP promoterAAA; AD1; PN2; ABPP; APPI; CVAP; ABETA; CTFgamma1,472 bp++++PDF
AQP3RDB07311pGL4-phAQP3Promoter collection, Human AQP3 promoterGIL1,219 bp19.0 17.0 93.3 PDF
ARRDB07690pGL4-phARPromoter collection, Human AR promoterKD; AIS; TFM; DHTR; SBMA; HYSP1; NR3C4; SMAX1; HUMARA1,490 bp19.3 ++++PDF
ARNTRDB07731pGL4-phARNTPromoter collection, Human ARNT promoterHIF1B; TANGO; bHLHe2; HIF1BETA; HIF-1beta1,462 bp203.0 214.3 191.8 PDF
ASNSRDB07305pGL4-phASNSPromoter collection, Human ASNS promoterTS111,253 bp1104.0 254.0 6536.7 PDF
ATF2RDB07712pGL4-phATF2Promoter collection, Human ATF2 promoterHB16; CREB2; TREB7; CRE-BP1; MGC1115581,470 bp140.0 82.8 67.6 PDF
ATF3RDB07710pGL4-phATF3Promoter collection, Human ATF3 promoter 1,482 bp40.0 54.5 43.3 PDF
ATRRDB07334pGL4-phATRPromoter collection, Human ATR promoterFRP1; MEC1; SCKL; SCKL11,147 bp105.5 408.0 308.0 PDF
B2MRDB07479pGL4-phB2MPromoter collection, Human B2M promoter 1,420 bp339.5 +++PDF
BAI1RDB07401pGL4-phBAI1Promoter collection, Human BAI1 promoterGDAIF; FLJ419881,368 bp+++PDF
BAK1RDB07318pGL4-phBAK1Promoter collection, Human BAK1 promoterBAK; CDN1; BCL2L7; MGC3887; BAK-LIKE; MGC1172551,193 bp22.0 91.0 34.0 PDF
BCL2RDB07567pGL4-phBCL2Promoter collection, Human BCL2 promoterBcl-21,347 bp21.0 ++++PDF
BCL2L1RDB07335pGL4-phBCL2L1Promoter collection, Human BCL2L1 promoterBCLX; BCL2L; BCLXL; BCLXS; Bcl-X; bcl-xL; bcl-xS; BCL-XL/S; DKFZp781P20921,214 bp++56.0 147.0 PDF
BRCA1RDB07296pGL4-phBRCA1Promoter collection, Human BRCA1 promoterIRIS; PSCP; BRCAI; BRCC1; PNCA4; RNF53; BROVCA11,130 bp44.5 42.0 238.0 PDF
BRCA2RDB07691pGL4-phBRCA2Promoter collection, Human BRCA2 promoterFAD; FACD; FAD1; GLM3; BRCC2; FANCB; FANCD; PNCA2; FANCD1; BROVCA21,474 bp48.0 22.0 49.9 PDF
BTG2RDB07402pGL4-phBTG2Promoter collection, Human BTG2 promoterPC3; TIS21; MGC126063; MGC1260641,356 bp285.0 1162.0 271.0 PDF
C12orf5RDB07414pGL4-phC12orf5Promoter collection, Human C12orf5 promoterTIGAR1,335 bp63.0 234.0 138.0 PDF
CABLES1RDB07337pGL4-phCABLES1Promoter collection, Human CABLES1 promoterIK3-1; CABLES; HsT2563; FLJ359241,222 bp--+PDF
CALCARDB07291pGL4-phCALCAPromoter collection, Human CALCA promoterCT; KC; CGRP; CALC1; CGRP1; CGRP-I; MGC1266481,321 bp271.0 105.0 322.0 PDF
CASP1RDB07338pGL4-phCASP1Promoter collection, Human CASP1 promoterICE; P45; IL1BC1,169 bp++16.0 20.0 PDF
CAV1RDB07364pGL4-phCAV1Promoter collection, Human CAV1 promoterCGL3; BSCL3; VIP21; MSTP0851,309 bp+-+PDF
CCND1RDB07299pGL4-phCCND1Promoter collection, Human CCND1 promoterBCL1; PRAD1; U21B31; D11S287E1,191 bp+170.0 ++PDF
CD44RDB07685pGL4-phCD44Promoter collection, Human CD44 promoterIN; LHR; MC56; MDU2; MDU3; MIC4; Pgp1; CDW44; CSPG8; HCELL; HUTCH-I; ECMR-III; MGC104681,460 bp++--PDF
CD55RDB07539pGL4-phCD55Promoter collection, Human CD55 promoterCR; TC; DAF; CROM1,432 bp++++PDF
CD82RDB07416pGL4-phCD82Promoter collection, Human CD82 promoterR2; 4F9; C33; IA4; ST6; GR15; KAI1; SAR2; TSPAN271,319 bp96.5 192.0 30.5 PDF
CDC2RDB07816pGL4-phCDC2Promoter collection, Human CDC2 promoterCDC28A; P34CDC2; MGC111195; DKFZp686L20222; CDK11,477 bp186.0 36.8 17.1 PDF
CDC25ARDB07709pGL4-phCDC25APromoter collection, Human CDC25A promoterCDC25A21,460 bp148.3 33.5 72.4 PDF
CDK4RDB07907pGL4-phCDK4Promoter collection, Human CDK4 promoterCMM3; PSK-J3; MGC144581,498 bp108.5 43.3 27.5 PDF
CDKN1ARDB07302pGL4-phCDKN1APromoter collection, Human CDKN1A promoterP21; CIP1; SDI1; WAF1; CAP20; CDKN1; MDA-6; p21CIP11,203 bp29.0 78.0 38.0 PDF
CEBPARDB07812pGL4-phCEBPAPromoter collection, Human CEBPA promoterCEBP; C/EBP-alpha1,498 bp66.5 33.5 35.1 PDF
CEBPERDB07713pGL4-phCEBPEPromoter collection, Human CEBPE promoterCRP1; C/EBP-epsilon1,464 bp+--PDF
CGARDB07456pGL4-phCGAPromoter collection, Human CGA promoterHCG; LHA; FSHA; GPHa; TSHA; GPHA1; CG-ALPHA1,273 bp137.0 31.0 573.3 PDF
CHEK1RDB07319pGL4-phCHEK1Promoter collection, Human CHEK1 promoterCHK11,208 bp83.5 31.0 110.0 PDF
CHEK2RDB07407pGL4-phCHEK2Promoter collection, Human CHEK2 promoterCDS1; CHK2; LFS2; RAD53; HuCds1; PP14251,312 bp57.0 80.0 34.0 PDF
CHUKRDB07383pGL4-phCHUKPromoter collection, Human CHUK promoterIKK1; IKKA; IKBKA; TCF16; NFKBIKA; IKK-alpha1,315 bp767.0 820.0 944.0 PDF
COL1A1RDB07459pGL4-phCOL1A1Promoter collection, Human COL1A1 promoterOI41,260 bp240.5 ++10.8 PDF
CREMRDB07811pGL4-phCREMPromoter collection, Human CREM promoterICER; hCREM-2; MGC17881; MGC41893; MGC1111101,462 bp195.5 110.5 120.8 PDF
CSF2RDB07482pGL4-phCSF2Promoter collection, Human CSF2 promoterGMCSF; MGC131935; MGC1388971,418 bp+++-PDF
CSNK2A1RDB07483pGL4-phCSNK2A1Promoter collection, Human CSNK2A1 promoterCKII; CK2A11,402 bp94.0 64.0 78.3 PDF
CTGFRDB07807pGL4-phCTGFPromoter collection, Human CTGF promoterCCN2; NOV2; HCS24; IGFBP8; MGC1028391,493 bp248.5 102.5 16.6 PDF
CX3CL1RDB07340pGL4-phCX3CL1Promoter collection, Human CX3CL1 promoterNTN; NTT; CXC3; CXC3C; SCYD1; ABCD-3; C3Xkine; fractalkine; neurotactin1,236 bp--+PDF
CXCL12RDB07687pGL4-phCXCL12Promoter collection, Human CXCL12 promoterIRH; PBSF; SDF1; TLSF; SDF1A; SDF1B; TPAR1; SCYB121,470 bp21.0 27.3 14.3 PDF
CYP11A1RDB07460pGL4-phCYP11A1Promoter collection, Human CYP11A1promoterCYP11A; P450SCC1,218 bp++-PDF
CYP1A1RDB07541pGL4-phCYP1A1Promoter collection, Human CYP1A1 promoterAHH; AHRR; CP11; CYP1; P1-450; P450-C; P450DX1,462 bp590.7 43.8 33.5 PDF
DDCRDB07555pGL4-phDDCPromoter collection, Human DDC promoterAADC1,498 bp21.3 +-PDF
DKK1RDB07341pGL4-phDKK1Promoter collection, Human DKK1 promoterSK; DKK-11,166 bp20.5 35.0 44.0 PDF
DRAMRDB07412pGL4-phDRAMPromoter collection, Human DRAM promoterFLJ11259; DRAM11,346 bp59.5 62.0 15.0 PDF
DUSP1RDB07368pGL4-phDUSP1Promoter collection, Human DUSP1 promoterHVH1; MKP1; CL100; MKP-1; PTPN101,165 bp173.8 176.8 1083.5 PDF
DUSP12RDB07384pGL4-phDUSP12Promoter collection, Human DUSP12 promoterYVH1; DUSP11,310 bp1593.0 1221.0 1937.0 PDF
E2F1RDB07810pGL4-phE2F1Promoter collection, Human E2F1 promoterRBP3; E2F-1; RBAP1; RBBP31,473 bp63.5 ++10.6 PDF
E2F2RDB07904pGL4-phE2F2Promoter collection, Human E2F2 promoterE2F-21,469 bp32.5 ++PDF
E2F4RDB07714pGL4-phE2F4Promoter collection, Human E2F4 promoterE2F-41,470 bp891.0 289.0 317.1 PDF
EGFRRDB07398pGL4-phEGFRPromoter collection, Human EGFR promoterERBB; HER1; mENA; ERBB1; PIG611,340 bp31.0 26.0 65.0 PDF
EGR1RDB07369pGL4-phEGR1Promoter collection, Human EGR1 promoterTIS8; AT225; G0S30; NGFI-A; ZNF225; KROX-24; ZIF-2681,310 bp1594.3 605.0 5730.0 PDF
ELK1RDB07908pGL4-phELK1Promoter collection, Human ELK1 promoter 1,470 bp58.5 31.0 20.9 PDF
EPCAMRDB07367pGL4-phEPCAMPromoter collection, HumanEPCAM promoterESA; KSA; M4S1; MK-1; DIAR5; EGP-2; EGP40; KS1/4; MIC18; TROP1; EGP314; HNPCC8; GA733-2; TACSTD11,511 bp--28.5 PDF
EPHA2RDB07342pGL4-phEPHA2Promoter collection, Human EPHA2 promoterECK; ARCC21,163 bp26.0 152.0 81.0 PDF
ESR1RDB07528pGL4-phESR1Promoter collection, Human ESR1 promoterER; ESR; Era; ESRA; NR3A1; DKFZp686N231231,438 bp+++-PDF
ETS1RDB07819pGL4-phETS1Promoter collection, Human ETS1 promoterETS-1; EWSR2; FLJ107681,475 bp82.0 36.3 16.1 PDF
EZH2RDB07370pGL4-phEZH2Promoter collection, Human EZH2 promoterENX1; EZH1; KMT6; ENX-1; KMT6A; MGC91691,205 bp++++65.5 PDF
F3RDB07458pGL4-phF3Promoter collection, Human F3 promoterTF; TFA; CD142; FLJ179601,258 bp40.0 13.0 10.0 PDF
F8RDB07519pGL4-phF8Promoter collection, Human F8 promoterAHF; F8B; F8C; HEMA; FVIII; DXS1253E1,376 bp+--PDF
FASRDB07349pGL4-phFASPromoter collection, Human FAS promoterAPT1; CD95; FAS1; APO-1; FASTM; ALPS1A; TNFRSF61,331 bp-+++PDF
FDXRRDB07385pGL4-phFDXRPromoter collection, Human FDXR promoterADXR1,353 bp756.0 2295.0 921.0 PDF
FLT1RDB07726pGL4-phFLT1Promoter collection, Human FLT1 promoterFLT; VEGFR11,466 bp82.0 10.5 ++PDF
FOSRDB07292pGL4-phFOSPromoter collection, Human FOS promoterAP-1; C-FOS1,261 bp213.0 180.0 150.0 PDF
FOSL1RDB07476pGL4-phFOSL1Promoter collection, Human FOSL1 promoterFRA; FRA1; fra-11,321 bp12.5 ++++PDF
GADD45ARDB07320pGL4-phGADD45APromoter collection, Human GADD45A promoterDDIT1; GADD451,225 bp214.5 675.0 313.0 PDF
GADD45BRDB07529pGL4-phGADD45BPromoter collection, Human GADD45B promoterMYD118; GADD45BETA; DKFZp566B1331,506 bp2122.7 268.5 132.5 PDF
GH2RDB07309pGL4-phGH2Promoter collection, Human GH2 promoterGHL; GHV; GH-V; hGH-V1,167 bp92.0 12.0 90.0 PDF
GJA1RDB07538pGL4-phGJA1Promoter collection, Human GJA1 promoterHSS; CX43; GJAL; ODDD; DFNB381,256 bp16.4 ++++PDF
GLI1RDB07902pGL4-phGLI1Promoter collection, Human GLI1 promoterGLI1,470 bp+++PDF
GMLRDB07371pGL4-phGMLPromoter collection, Human GML promoterLY6DL1,308 bp-+++PDF
GSTP1RDB07477pGL4-phGSTP1Promoter collection, Human GSTP1 promoterPI; DFN7; GST3; GSTP; FAEES31,243 bp93.0 294.4 99.2 PDF
HDAC1RDB07484pGL4-phHDAC1Promoter collection, Human HDAC1 promoterHD1; RPD3; GON-10; RPD3L1; DKFZp686H122031,471 bp42.0 156.0 141.3 PDF
HIF1ARDB07693pGL4-phHIF1APromoter collection, Human HIF1A promoterHIF1; MOP1; PASD8; bHLHe78; HIF-1alpha; HIF1-ALPHA1,469 bp15.3 25.3 33.0 PDF
HIST2H2ABRDB07909pGL4-phHIST2H2ABPromoter collection, Human HIST2H2AB promoter 1,461 bp2425.0 100.8 102.3 PDF
HLA-DQB1RDB07557pGL4-phHLA-DQB1Promoter collection, Human HLA-DQB1 promoterIDDM1; CELIAC1; HLA-DQB1,468 bp30.7 10.5 ++PDF
HLA-DRARDB07389pGL4-phHLA-DRAPromoter collection, Human HLA-DRA promoterMLRW; FLJ51114; HLA-DRA11,423 bp44.0 +++PDF
HLA-ERDB07388pGL4-phHLA-EPromoter collection, Human HLA-E promoterMHC; QA1; EA1.2; EA2.1; HLA-6.2; DKFZp686P192181,160 bp134.0 75.0 453.3 PDF
HMOX1RDB07485pGL4-phHMOX1Promoter collection, Human HMOX1 promoterHO-1; HSP32; bK286B101,470 bp45.5 ++++PDF
HNF4ARDB07534pGL4-phHNF4APromoter collection, Human HNF4A promoterTCF; HNF4; MODY; MODY1; NR2A1; TCF14; HNF4a7; HNF4a8; HNF4a9; NR2A21; FLJ39654; HNF4alpha1,485 bp++-PDF
HPGDRDB07457pGL4-phHPGDPromoter collection, Human HPGD promoterPGDH; PGDH1; 15-PGDH; SDR36C11,227 bp++13.3 PDF
HSP90AB1RDB07321pGL4-phHSP90AB1Promoter collection, Human HSP90AB1 promoterHSPC2; HSPCB; D6S182; HSP90B; FLJ26984; HSP90-BETA1,216 bp503.5 560.0 596.0 PDF
HSPB1RDB07530pGL4-phHSPB1Promoter collection, Human HSPB1 promoterCMT2F; HMN2B; HSP27; HSP28; Hsp25; SRP27; HS.76067; DKFZp586P13221,485 bp27.0 56.3 ++PDF
ICAM1RDB07390pGL4-phICAM1Promoter collection, Human ICAM1 promoterBB2; CD54; P3.581,327 bp17.5 +++PDF
ID2RDB07306pGL4-phID2Promoter collection, Human ID2 promoterGIG8; ID2A; ID2H; bHLHb26; MGC263891,473 bp1140.0 316.0 2603.3 PDF
IFI16RDB07372pGL4-phIFI16Promoter collection, Human IFI16 promoterPYHIN2; IFNGIP1; MGC94661,316 bp++++61.5 PDF
IFNGRDB07297pGL4-phIFNGPromoter collection, Human IFNG promoterIFG; IFI1,216 bp12.0 +21.0 PDF
IFNGR1RDB07708pGL4-phIFNGR1Promoter collection, Human IFNGR1 promoterCD119; IFNGR; FLJ457341,466 bp213.0 167.5 176.9 PDF
IGF2RDB07727pGL4-phIGF2Promoter collection, Human IGF2 promoterINSIGF; pp9974; C11orf43; FLJ22066; FLJ447341,460 bp18.0 +++PDF
IGFBP3RDB07568pGL4-phIGFBP3Promoter collection, Human IGFBP3 promoterIBP3; BP-531,202 bp119.0 49.5 22.2 PDF
IL1ARDB07682pGL4-phIL1APromoter collection, Human IL1A promoterIL1; IL-1A; IL1F1; IL1-ALPHA1,494 bp---PDF
IL2RDB07391pGL4-phIL2Promoter collection, Human IL2 promoterIL-2; TCGF; lymphokine1,246 bp---PDF
IL2RARDB07525pGL4-phIL2RAPromoter collection, Human IL2RA promoterCD25; IL2R; TCGFR; IDDM101,473 bp---PDF
IL5RDB07392pGL4-phIL5Promoter collection, Human IL5 promoterEDF; TRF; IL-51,277 bp---PDF
IL6RDB07313pGL4-phIL6Promoter collection, Human IL6 promoterHGF; HSF; BSF2; IL-6; IFNB21,299 bp94.5 -++PDF
IL8RDB07322pGL4-phIL8Promoter collection, Human IL8 promoterNAF; GCP1; LECT; LUCT; NAP1; CXCL8; GCP-1; LYNAP; MDNCF; MONAP; NAP-11,263 bp376.5 1675.0 568.0 PDF
INSRDB07387pGL4-phINSPromoter collection, Human INS promoterILPR; IRDN; IDDM2; MODY101,263 bp++++PDF
IRF3RDB07821pGL4-phIRF3Promoter collection, Human IRF3 promoter 1,473 bp37.0 37.0 27.8 PDF
JUNRDB07298pGL4-phJUNPromoter collection, Human JUN promoterAP1; AP-1; c-Jun1,164 bp329.5 2332.0 770.0 PDF
KLK3RDB07324pGL4-phKLK3Promoter collection, Human KLK3 promoterAPS; PSA; hK3; KLK2A11,182 bp+++++PDF
KLKB1RDB07373pGL4-phKLKB1Promoter collection, Human KLKB1 promoterPPK; KLK31,304 bp++++++PDF
LEF1RDB07553pGL4-phLEF1Promoter collection, Human LEF1 promoterFLJ46390; TCF1ALPHA; DKFZp586H09191,505 bp+++-PDF
LEPRDB07688pGL4-phLEPPromoter collection, Human LEP promoterOB; OBS; FLJ941141,457 bp++++PDF
LIFRDB07417pGL4-phLIFPromoter collection, Human LIF promoterCDF; DIA; HILDA1,304 bp++++PDF
LTARDB07486pGL4-phLTAPromoter collection, Human LTA promoterLT; TNFB; TNFSF11,408 bp---PDF
MAD1L1RDB07374pGL4-phMAD1L1Promoter collection, Human MAD1L1 promoterMAD1; PIG9; TP53I9; TXBP1811,379 bp472.0 450.0 901.0 PDF
MAT2ARDB07393pGL4-phMAT2APromoter collection, Human MAT2A promoterMATA2; MATII; SAMS21,277 bp237.5 247.0 381.5 PDF
MDM2RDB07403pGL4-phMDM2Promoter collection, Human MDM2 promoterHDMX; hdm2; MGC5370; MGC712211,319 bp++48.0 30.0 PDF
MDM4RDB07418pGL4-phMDM4Promoter collection, Human MDM4 promoterHDMX; MDMX; MRP1; MGC132766; DKFZp781B14231,319 bp669.0 885.0 475.0 PDF
METRDB07554pGL4-phMETPromoter collection, Human MET promoterHGFR; AUTS9; RCCP2; c-Met1,457 bp+++PDF
MGPRDB07394pGL4-phMGPPromoter collection, Human MGP promoterNTI; GIG36; MGLAP1,292 bp++--PDF
MIFRDB07913pGL4-phMIFPromoter collection, Human MIF promoterGIF; GLIF; MMIF1,460 bp40.0 34.0 50.8 PDF
MKI67RDB07323pGL4-phMKI67Promoter collection, Human MKI67 promoterKIA; MKI671,419 bp60.5 153.0 46.0 PDF
MMP2RDB07314pGL4-phMMP2Promoter collection, Human MMP2 promoterCLG4; MONA; CLG4A; TBE-1; MMP-II1,160 bp+++++PDF
MMP3RDB07535pGL4-phMMP3Promoter collection, Human MMP3 promoterSL-1; STMY; STR1; CHDS6; MMP-3; STMY1; MGC126102; MGC126103; MGC1261041,364 bp+18.1 -PDF
MMP7RDB07536pGL4-phMMP7Promoter collection, Human MMP7 promoterMMP-7; MPSL1; PUMP-11,386 bp+--PDF
MMP9RDB07537pGL4-phMMP9Promoter collection, Human MMP9 promoterGELB; CLG4B; MMP-9; MANDP21,345 bp++--PDF
MT1ARDB07513pGL4-phMT1APromoter collection, Human MT1A promoterMT1; MTC; MT1S; MGC328481,301 bp61.8 59.1 25.2 PDF
MYBRDB07480pGL4-phMYBPromoter collection, Human MYB promoterefg; Cmyb; c-myb; c-myb_CDS1,435 bp+++24.2 PDF
MYCRDB07325pGL4-phMYCPromoter collection, Human MYC promoterMRTL; c-Myc; bHLHe391,267 bp++++10.0 PDF
MYCNRDB07820pGL4-phMYCNPromoter collection, Human MYCN promoterNMYC; ODED; MODED; N-myc; bHLHe371,469 bp30.0 +++PDF
NFATC4RDB07376pGL4-phNFATC4Promoter collection, Human NFATC4 promoterNFAT3; NF-ATc41,315 bp33.0 19.0 47.0 PDF
NFICRDB07399pGL4-phNFICPromoter collection, Human NFIC promoterCTF; NFI; CTF5; NF-I; MGC201531,152 bp53.0 26.0 59.0 PDF
NFKB2RDB07478pGL4-phNFKB2Promoter collection, Human NF-KB2 promoterp52; LYT10; LYT-10; NF-KB21,322 bp718.8 83.5 44.5 PDF
NLRC4RDB07406pGL4-phNLRC4Promoter collection, Human NLRC4 promoterCLAN; IPAF; CLAN1; CLANA; CLANB; CLANC; CLAND; CARD12; CLR2.11,318 bp-++PDF
NME1RDB07326pGL4-phNME1Promoter collection, Human NME1 promoterNB; AWD; NBS; GAAD; NM23; NDPKA; NDPK-A; NM23-H11,243 bp606.5 622.0 709.0 PDF
NOS2RDB07377pGL4-phNOS2Promoter collection, Human NOS2 promoterNOS; INOS; NOS2A; HEP-NOS1,304 bp21.0 ++13.0 PDF
NQO1RDB07570pGL4-phNQO1Promoter collection, Human NQO1 promoterDTD; QR1; DHQU; DIA4; NMOR1; NMORI1,399 bp998.5 209.2 98.2 PDF
NR3C1RDB07689pGL4-phNR3C1Promoter collection, Human NR3C1 promoterGR; GCR; GRL; GCCR1,492 bp13.7 +++PDF
NTSRDB07308pGL4-phNTSPromoter collection, Human NTS promoterNN; NT; NT/N; NTS1; NMN-1251,213 bp138.0 38.0 303.3 PDF
PARP1RDB07725pGL4-phPARP1Promoter collection, Human PARP1 promoterPARP; PPOL; ADPRT; ADPRT1; PARP-1; ADPRT 1; pADPRT-11,465 bp67.5 56.5 79.6 PDF
PAX1RDB07910pGL4-phPAX1Promoter collection, Human PAX1 promoterHUP481,490 bp24.0 ++PDF
PAX6RDB07911pGL4-phPAX6Promoter collection, Human PAX6 promoterAN; AN2; MGDA; WAGR; D11S812E; MGC172091,460 bp+++-PDF
PAX8RDB07906pGL4-phPAX8Promoter collection, Human PAX8 promoter 1,482 bp+++-PDF
PCNARDB07365pGL4-phPCNAPromoter collection, Human PCNA promoterMGC83671,203 bp50.0 46.8 214.0 PDF
PDHA1RDB07514pGL4-phPDHA1Promoter collection, Human PDHA1 promoterPDHA; PHE1A; PDHCE1A1,455 bp262.3 274.9 140.1 PDF
PENKRDB07293pGL4-phPENKPromoter collection, Human PENK promoter 1,271 bp11.0 ++40.0 PDF
PERPRDB07411pGL4-phPERPPromoter collection, Human PERP promoterTHW; KCP1; PIGPC1; KRTCAP1; dJ496H19.1; RP3-496H19.11,468 bp++12.0 ++PDF
PGRRDB07809pGL4-phPGRPromoter collection, Human PGR promoterPR; NR3C31,471 bp26.0 +++PDF
PLATRDB07295pGL4-phPLATPromoter collection, Human PLAT promoterTPA; T-PA; DKFZp686I031481, 027 bp+++PDF
PLAURDB07487pGL4-phPLAUPromoter collection, Human PLAU promoterATF; UPA; URK; u-PA1,403 bp+20.5 +PDF
PLAURRDB07312pGL4-phPLAURPromoter collection, Human PLAUR promoterCD87; UPAR; URKR1,220 bp-++PDF
PLK1RDB07327pGL4-phPLK1Promoter collection, Human PLK1 promoterPLK; STPK131,221 bp11.0 24.0 15.0 PDF
PMLRDB07343pGL4-phPMLPromoter collection, Human PML promoterMYL; RNF71; PP8675; TRIM191,305 bp15.5 115.0 174.0 PDF
POLD1RDB07344pGL4-phPOLD1Promoter collection, Human POLD1 promoterCDC2; POLD1,308 bp200.0 145.0 238.0 PDF
POU5F1RDB07912pGL4-phPOU5F1Promoter collection, Human POU5F1 promoterOCT3; OCT4; OTF3; OTF4; OTF-3; Oct-3; Oct-4; MGC224871,492 bp28.5 ++PDF
PPP1R15ARDB07307pGL4-phPPP1R15APromoter collection, Human PPP1R15A promoterGADD341,222 bp1042.0 626.0 6010.0 PDF
PPP2R4RDB07294pGL4-phPPP2R4Promoter collection, Human PPP2R4 promoterPP2A; PR53; PTPA; MGC21841,217 bp498.0 123.0 870.0 PDF
PRKAB1RDB07328pGL4-phPRKAB1Promoter collection, Human PRKAB1 promoterAMPK; HAMPKb; MGC177851,173 bp559.5 1031.0 702.0 PDF
PSAPRDB07515pGL4-phPSAPPromoter collection, Human PSAP promoterGLBA; SAP1; FLJ00245; MGC1109931,418 bp219.6 268.4 133.1 PDF
PTENRDB07400pGL4-phPTENPromoter collection, Human PTEN promoterBZS; DEC; GLM2; MHAM; TEP1; MMAC1; PTEN1; 10q23del; MGC112271,442 bp+75.0 ++PDF
PTGS2RDB07300pGL4-phPTGS2Promoter collection, Human PTGS2 promoterCOX2; COX-2; PHS-2; PGG/HS; PGHS-2; hCox-2; GRIPGHS1,253 bp51.5 11.0 88.0 PDF
PTTG1RDB07329pGL4-phPTTG1Promoter collection, Human PTTG1 promoterEAP1; PTTG; HPTTG; TUTR1; MGC126883; MGC1382761,222 bp43.5 14.0 29.0 PDF
RAD51RDB07813pGL4-phRAD51Promoter collection, Human RAD51 promoterRECA; BRCC5; HRAD51; RAD51A; HsRad51; HsT169301,466 bp41.5 12.3 12.8 PDF
RARBRDB07905pGL4-phRARBPromoter collection, Human RARB promoterHAP; RRB2; NR1B21,463 bp++27.3 13.4 PDF
RARGRDB07903pGL4-phRARGPromoter collection, Human RARG promoterRARC; NR1B31,467 bp14.0 ++PDF
RB1RDB07345pGL4-phRB1Promoter collection, Human RB1 promoterRB; pRb; OSRC; pp110; p105-Rb1,333 bp175.0 375.0 526.0 PDF
RELRDB07481pGL4-phRELPromoter collection, Human RELpromoterC-Rel1,438 bp39.0 30.0 24.8 PDF
RELARDB07366pGL4-phRELAPromoter collection, Human RELA promoterp65; NFKB3; MGC1317741,149 bp136.8 73.0 399.0 PDF
RHOARDB07404pGL4-phRHOAPromoter collection, Human RHOA promoterARHA; ARH12; RHO12; RHOH121,316 bp258.0 296.0 422.0 PDF
RPRMRDB07409pGL4-phRPRMPromoter collection, Human RPRM promoterREPRIMO; FLJ903271,300 bp13.5 31.0 25.0 PDF
RRM2BRDB07346pGL4-phRRM2BPromoter collection, Human RRM2B promoterP53R2; MGC42116; MGC102856; DKFZp686M052481,323 bp++24.3 72.5 PDF
SCO2RDB07415pGL4-phSCO2Promoter collection, Human SCO2 promoterSCO1L; MGC125823; MGC1258251,315 bp333.5 660.0 124.5 PDF
SERPINE1RDB07461pGL4-phSERPINE1Promoter collection, Human SERPINE1 promoterPAI; PAI1; PAI-1; PLANH11,449 bp234.5 127.0 33.5 PDF
SESN2RDB07413pGL4-phSESN2Promoter collection, Human SESN2 promoterHI95; SES2; SEST2; DKFZp761M0212; DKFZp761M021211,321 bp759.5 64.0 519.0 PDF
SFNRDB07408pGL4-phSFNPromoter collection, Human SFN promoterYWHAS1,352 bp49.0 105.0 158.0 PDF
SLC2A1RDB07814pGL4-phSLC2A1Promoter collection, Human SLC2A1 promoterPED; GLUT; DYT17; DYT18; GLUT1; GLUT1DS; MGC141895; MGC1418961,301 bp-++PDF
SMAD1RDB07732pGL4-phSMAD1Promoter collection, Human SMAD1 promoterBSP1; JV41; JV4-1; MADH1; MADR11,467 bp14.5 ++++PDF
SMAD4RDB07733pGL4-phSMAD4Promoter collection, Human SMAD4 promoterJIP; DPC4; MADH41,496 bp222.0 126.8 94.5 PDF
SOD1RDB07686pGL4-phSOD1Promoter collection, Human SOD1 promoterALS; SOD; ALS1; IPOA; homodimer1,471 bp288.7 32.0 28.1 PDF
SP1RDB07531pGL4-phSP1Promoter collection, Human SP1 promoter 1,487 bp249.7 122.0 130.3 PDF
SP3RDB07817pGL4-phSP3Promoter collection, Human SP3 promoterSPR2; DKFZp686O16311,462 bp306.5 170.5 140.9 PDF
SPP1RDB07552pGL4-phSPP1Promoter collection, Human SPP1 promoterOPN; BNSP; BSPI; ETA-1; MGC1109401,422 bp+++PDF
SSTR2RDB07378pGL4-phSSTR2Promoter collection, Human SSTR2 promoter 1,320 bp48.0 57.0 116.0 PDF
STAT1RDB07405pGL4-phSTAT1Promoter collection, Human STAT1 promoterISGF-3; STAT91; DKFZp686B041001,313 bp46.5 198.0 103.0 PDF
STAT4RDB07711pGL4-phSTAT4Promoter collection, Human STAT1 promoterSLEB111,466 bp+--PDF
TBXAS1RDB07347pGL4-phTBXAS1Promoter collection, Human TBXAS1 promoterTS; TXS; CYP5; THAS; TXAS; CYP5A1; GHOSAL; FLJ527711,321 bp++46.3 25.5 PDF
TERTRDB07379pGL4-phTERTPromoter collection, Human TERT promoterTP2; TRT; EST2; TCS1; hEST21,341 bp76.0 27.0 90.0 PDF
TFRDB07540pGL4-phTFPromoter collection, Human TF promoterPRO1557; PRO2086; DKFZp781D01561,478 bp++35.8 ++PDF
TFF1RDB07511pGL4-phTFF1Promoter collection, Human TFF1 promoterpS2; BCEI; HPS2; HP1.A; pNR-2; D21S211,376 bp13.2 85.0 13.7 PDF
TGRDB07304pGL4-phTGPromoter collection, Human TG promoterTGN; AITD31,164 bp+++30.0 PDF
TGFARDB07348pGL4-phTGFAPromoter collection, Human TGFA promoterTFGA1,305 bp23.3 36.0 124.0 PDF
THRDB07301pGL4-phTHPromoter collection, Human TH promoterTYH; DYT14; DYT5b1,157 bp68.0 14.0 66.7 PDF
THBS1RDB07728pGL4-phTHBS1Promoter collection, Human THBS1 promoterTSP; THBS; TSP1; TSP-1; THBS-11,474 bp171.5 33.5 12.3 PDF
TIMP1RDB07516pGL4-phTIMP1Promoter collection, Human TIMP1 promoterEPA; EPO; HCI; CLGI; TIMP; FLJ903731,326 bp++-PDF
TNFRDB07310pGL4-phTNFPromoter collection, Human TNF promoterDIF; TNFA; TNFSF2; TNF-alpha1,176 bp42.0 30.0 31.0 PDF
TNFRSF10BRDB07380pGL4-phTNFRSF10BPromoter collection, Human TNFRSF10B promoterDR5; CD262; KILLER; TRICK2; TRICKB; ZTNFR9; TRAILR2; TRICK2A; TRICK2B; TRAIL-R2; KILLER/DR51,305 bp40.0 65.0 228.0 PDF
TNFRSF10CRDB07375pGL4-phTNFRSF10CPromoter collection, Human TNFRSF10C promoterLIT; DCR1; TRID; CD263; TRAILR3; TRAIL-R3; DCR1-TNFR; MGC149501; MGC1495021,329 bp16.0 ++13.0 PDF
TNFRSF11BRDB07533pGL4-phTNFRSF11BPromoter collection, Human TNFRSF11B promoterOPG; TR1; OCIF; MGC295651,475 bp++-PDF
TNFSF10RDB07526pGL4-phTNFSF10Promoter collection, Human TNFSF10 promoterTL2; APO2L; CD253; TRAIL; Apo-2L1,467 bp16.5 +++PDF
TNNC1RDB07517pGL4-phTNNC1Promoter collection, Human TNNC1 promoterTNC; TN-C; TNNC; CMD1Z; CMH131,369 bp+++-PDF
TP53RDB07330pGL4-phTP53Promoter collection, Human TP53 promoterP53; LFS1; TRP53; FLJ929431,187 bp56.0 93.0 133.0 PDF
TP53AIP1RDB07410pGL4-phTP53AIP1Promoter collection, Human TP53AIP1 promoterP53AIP11,305 bp+14.0 13.0 PDF
TP53TG5RDB07336pGL4-phTP53TG5Promoter collection, Human TP53TG5 promoterCLG01; C20orf101,270 bp--+PDF
TP63RDB07350pGL4-phTP63Promoter collection, Human TP63 promoterAIS; KET; LMS; NBP; RHS; p40; p51; p63; EEC3; OFC8; p73H; p73L; SHFM4; TP53L; TP73L; p53CP; TP53CP; B(p51A); B(p51B)1,330 bp+++72.5 PDF
TP73RDB07381pGL4-phTP73Promoter collection, Human TP73 promoterP731,332 bp10.0 14.0 41.0 PDF
TRIM22RDB07382pGL4-phTRIM22Promoter collection, Human TRIM22 promoterRNF94; STAF50; GPSTAF501,317 bp++++PDF
TTRRDB07815pGL4-phTTRPromoter collection, Human TTR promoterPALB; TBPA; HsT26511,461 bp10.0 88.0 22.6 PDF
TXNRDB07518pGL4-phTXNPromoter collection, Human TXN promoterTRX; TRX1; MGC61975; DKFZp686B19931,372 bp1676.1 197.3 95.2 PDF
VCANRDB07339pGL4-phVCANPromoter collection, Human VCAN promoterWGN; ERVR; GHAP; PG-M; WGN1; CSPG2; DKFZp686K061101,186 bp--+PDF
VEGFARDB07681pGL4-phVEGFAPromoter collection, Human VEGFA promoterVPF; VEGF; MVCD1; MGC706091,305 bp125.5 27.0 20.7 PDF
WRNRDB07569pGL4-phWRNPromoter collection, Human WRN promoterRECQ3; RECQL2; RECQL3; DKFZp686C20561,320 bp+--PDF
WT1RDB07822pGL4-phWT1Promoter collection, Human WT1 promoterGUD; AWT1; WAGR; WT33; WIT-21,466 bp++--PDF
XPCRDB07351pGL4-phXPCPromoter collection, Human XPC promoterXP3; RAD4; XPCC1,301 bp141.0 341.8 482.5 PDF
    From Entrez gene on 29.Sep.2010     

go to Head


2016.07.21