Home   Clone set   Gene Expression   Gene Analysis   Search   Literature  
BioResource Center RIKEN BRC DNA BANK
  Prev.

Genomic DNA Information

Reconstitution of DNA

  • In the case you received plastic vials contains precipitated DNA with ethanol.
  • A precipitant might stick to the lid or wall during transportation.
  • Before opening the tube, please spin down a minute or two at 5,000 g (~7,000 rpm, table top microfuge).
  • Please remove ethanol with pipet (DO NOT tooch precipitate!)
  • Immediately after removal of ethanol resuspend the DNA in an appropriate amount of TE buffer (10 mM Tris-Cl, pH 7.5, 1 mM EDTA), and dissolve the DNA pellet by gently tapping with fingers (DO NOT shake vigorously! A little amount of ethanol won't affect to many applications).
  • If the DNA is difficult to solve, leave the vial at 4 degreeC overnight to allow the DNA to dissolve.
  • Once reconstituted in TE buffer, the DNA should be stored at -30 degreeC.

Preparation of Genomic DNA

  1. Suspend bacteria cells in 8 ml of [0.7 M NaCl, 0.1 M EDTA (pH 8.0)] in 50 ml conical tube.
  2. Add 1 ml of 10 mg/ml lysozyme in PBS.
  3. Add 30 ul of 100 mg/ml labiase.
  4. Incubate mixture in 37oC water bath for 1 hour.
  5. Add 1 ml of [0.5 M tris-Cl (pH 7.5), 5% SDS].
  6. Add 25 ul of 10 mg/ml protease K.
  7. Incubate mixture at 60oC for 1 hour.
  8. Extraction of DNA with phenol.
  9. Extraction of DNA with phenol-chloroform.
  10. Extraction of DNA with chloroform-isoamyl alcohol (24:1).
  11. Precipitation of DNA with cold ethanol.
  12. Wash precipitated DNA with 70% ethanol.
  13. Dissolve DNA in 600 ul TE buffer with 1ul of 10 mg/ml RNaseA.
  14. Incubate DNA at 37oC for 30 min.
  15. Add 5 ul of 10 mg/ml protease K.
  16. Incubate DNA at 60oC for 1 hour.
  17. Extraction of DNA with phenol.
  18. Extraction of DNA with phenol-chloroform.
  19. Extraction of DNA with chloroform-isoamyl alcohol (24:1).
  20. Add 100 ul of 3 M sodium acetate (pH5.5).
  21. Add 1.2 ml cold ethanol.
  22. Wash precipitated DNA with 70% ethanol.
  23. Redissolve DNA in 200 ul TE buffer.
  24. Dilute 2 ul of DNA into 400 ul dH2O and analyze OD260.

Related Information

Primers for PCR of rRNA gene

Bacteria 16S rRNA
Name of primerSequence
EB-20F5' AGTTTGATCCTGGCTC 3'
EB-350F5' TACGGGAGGCAGCAG 3'
EB-1100R5' AGGGTTGCGCTCGTTG 3'
EB-1400R5' ACGGGCGGTGTGTAC 3'
EB-1530R5' AAGGAGGTGATCCAGCC 3'
Archaea 16S rRNA
Name of primerSequence
A-20F5' TCCGGTTGATCCTGCCG 3'
A-340F5' CCCAGGCCCTACGGG 3'
A-520R5' GTATTACCGCGGCGGCTG 3'
A-1100R5' CGGGTCTCGCTCGTT 3'
A-1400R5' GACGGGCGGTGTGTGC 3'
Fungi 26S rRNA
Name of primerSequence
ITS55' GGAAGTAAAAGTCGTAACAAGG 3'
ITS45' TCCTCCGCTTATTGATATGC 3'
NL15' GCATATCAATAAGCGGAGGAAAAG 3'
NL45' GGTCCGTGTTTCAAGACGG 3'

Reference

Itoh, T., Kudo, T., Oyaizu, H. and Seino, A. Two new species in the genus Actinomadura: A. glomerata sp. nov., and A. longicatena sp. nov. Actinomycetologica 9: 164-177, 1995. DOI: 10.3209/saj.9_164.

Namwong, S., Tanasupawat, S., Smitinont, T., Visessanguan, W., Kudo, T. and Itoh, T. Isolation of Lentibacillus salicampi strains and Lentibacillus juripiscarius sp. nov. from fish sauce in Thailand. Int. J. Syst. Evol. Microbiol. 55: 315-320, 2005. PMID: 15653893. DOI: 10.1099/ijs.0.63272-0.

Itoh, T., Suzuki, K. and Nakase, T. Occurrence of introns in the 16S rRNA genes of members of the genus Thermoproteus. Arch. Microbiol. 170: 155-161, 1998. PMID: 9683654. DOI: 10.1007/s002030050628.

Itoh, T., Suzuki, K., Sanchez, P. C. and Nakase, T. Caldisphaera lagunensis gen. nov., sp. nov., a novel thermoacidophilic crenarchaeote isolated from a hot spring at Mt Maquiling, Philippines. Int. J. Syst. Evol. Microbiol. 53: 1149-1154, 2003. PMID: 12892143. DOI: 10.1099/ijs.0.02580-0.

O’Donell, K. Fusarium and its near relatives, In: Reynolds, D. R. and Taylor, J. W. (eds.), The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics, pp. 225-233, CAB International, Wallingford, 1993.

White, T. J., Bruns, T., Lee, S., and Taylor, J. W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. (eds.), PCR Protocols: a Guide to Methods and Applications, pp. 315-322, Academic Press, New York, 1993.

Related Website

Related Articles

(T.M. 2012.02.28)

2016.06.03