Clone Search

Keywords

Resources for

Clontech Laboratories, Inc. and RIKEN BioResource Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

Clones & Vectors for Gene Expression
  Promoter collection
  Epitope tag fusion clones
  SEREX cDNA clone
  HLA antigen cDNA clone
  Nakamura & White RFLP clone

Resources for Gene Analysis
  Cultured microbe
  Cultured animal cell
  Experimental animal
  in vitro experiment
  Plant gene resources

Clone Set & Library
  Genomic clone
  cDNA clone
  Expression clone
  Libraries
  Others

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vector for Recombinant Virus

Genomic DNA
  JCM Microbial Genomic DNA
  BRC Mouse Genomic DNA

Search for resources
  Key word search
  Depositors List
  Gene Set Collection

Genome Network Project Human cDNA Clones


Genome Network Project Human cDNA Clone

The RIKEN BioResource Center is distributing copies of full-length human cDNA clones, produced and organized through the MEXT Genome Network Project to academia under its distribution policy.
There are two types of cDNA clone collections.
1) Human Full-Length cDNA clones
Approximately 30,000 clones corresponding to 60% of all human genes (14,000 genes) produced and organized by Dr. Sumio Sugano of the University of Tokyo and Dr. Yoshihide Hayashizaki of RIKEN OSC.
2) Human GatewayR Entry clones
Approximately 50,000 clones corresponding to 6,300 genes produced by cloning PCR-amplified open reading frame (ORF) fragments from the human full-length cDNA clones and studied through the government-supported MEXT Genome Network Project. DNA fragments cloned into GatewayR entry clones can be transferred into one or more destination vectors simultaneously using GatewayR technology. The GatewayR Entry clones include clones made from cDNA created by the Research Association for Biotechnology (RAB) under the New Energy and Industrial Technology Development Organization (NEDO) Full-length Human cDNA Sequencing Project.

Results of the project attained using the Genome Network Project cDNA clones have appeared in journals including Nature Genetics. Detailed information on these clones is available via the Genome Network Platform (http://genomenetwork.nig.ac.jp/).

References:

The papers describing these libraries have been published in journals indicated below:

  1. Ota T. et al., Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36: 40-45, 2004.
  2. Otsuki T. et al., Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. DNA Res., 12: 117-126, 2005.
  3. Kimura K. et al., Diversification of transcriptional modulation: Large-scale identification and characterization of putative alternative promoters of human genes. Genome Res., 16: 55-65, 2006.
  4. Itoh M., Yasunishi A., Imamura K., Kanamori M., Suzuki H., Suzuki M., Carninci P., Kawai J., Hayashizaki Y. Constructing ORFeome resources with removable termination codons, Biotechniques, 41: 44-48, 2006.

 

  • For more information about GatewayR technology, please visit the website of Invitrogen.
  • GatewayR is a registered trademark of Invitrogen.
  • Please visit the website of the Biological Resource Center (NBRC) at the National Institute of Technology and Evaluation (NITE) for more information about cDNA of the NEDO Full-length Human cDNA Sequencing Project.

Ordering Genome Network Project Clones

in Japanese
Terms and Conditions for distribution:
For use in academic research by non-profit organizations

  1. Please cite the following literature when publishing research results obtained by use of the BIOLOGICAL RESOURCE:
    • Ota T. et al., Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36: 40-45, 2004.
    • Otsuki T. et al., Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. DNA Res., 12: 117-126, 2005.
    • Kimura K. et al., Diversification of transcriptional modulation: Large-scale identification and characterization of putative alternative promoters of human genes. Genome Res., 16: 55-65, 2006.
    • Itoh M., Yasunishi A., Imamura K., Kanamori M., Suzuki H., Suzuki M., Carninci P., Kawai J., Hayashizaki Y. Constructing ORFeome resources with removable termination codons, Biotechniques, 41: 44-48, 2006.
  2. When publishing research results obtained by use of the BIOLOGICAL RESOURCE, please include acknowledgments to the Research Association for Biotechnology, to Dr. Yoshihide Hayashizaki of RIKEN OSC, and to Dr. Sumio Sugano of Tokyo University Graduate School.
  3. The Research Association for Biotechnology does not warrant that the use of the BIOLOGICAL RESOURCE by the RECIPIENT will not infringe any patent, copyright, trademark or other intellectual property rights of third parties.
  4. When publishing research results obtained by use of the BIOLOGICAL RESOURCE, please also: (a) indicate the name of resource, and (b) mention that the materials were provided by the RIKEN BRC. [Example: (name of BIOLOGICAL RESOURCE) was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT, Japan.]

Uses other than for academic research by non-profit institutions:

    Please contact the Gene Engineering Division.
Distribution fee per clone:
8,640 YEN (For use in research for not-for-profit academic purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Here [link].

In the case of GatewayR Expression Clone (pCMV SPORT6 and related vectors), users are asked to pay RIKEN BRC an additional 1,250 YEN per clone that includes the license fee, handling of currency exchange, money transfer and other expense.
More information for the license fee is HERE
Information for the backbone vectors is HERE.

Form:
DNA solution with TE buffer (approx. 1 microgram) per clone.
Remarks:
Terminal nucleotide sequences of cDNA are checked prior to delivery.
Please allow 2 weeks before shipment.

If you have any questions regarding our DNA resources or related matters, please feel free to contact the Gene Engineering Division.

Clone search

site search

Browse by A to Z list

  • Browse your interesting gene by A to Z list sorted by locus symbol.

Search by GNP Viewer

  • Please find your concerning clones by a clone finding system in the Genome Network Platform ViewerSearch.
  • icon is appeared in the “Resource” column.
  • If clones are available, icon is appeared in the “Resource” column.
  • Click icon in the “Resource” column and look at the Clone Information appeared in a popup window.
  • You can find your concerning clones also in the Human Full-Length cDNA Clone (constructed by RIKEN OSC), the GatewayR Entry Clone (constructed by Tokyo University) and the GatewayR Entry Clone (constructed by RIKEN OSC).

In the case of Full-Length Clone

  • Full-Length Clone(s) is indicated as “IRxxxxxxxx” in the “Clone:” column.
  • Link of the insert sequence is indicated in the “Accession:” column. Please make sure if or not your desired sequence is included.
  • The name of vector appears in “Vector:”. Please confirm the name of vector. In the case of GatewayR Expression Clone (pCMV SPORT6 and related vectors), users are asked to pay RIKEN BRC an additional 1,250 YEN per clone that includes the license fee, handling of currency exchange, money transfer and other expense.

In the case of Entry Clone

  • Entry Clone(s) is indicated as “W01xxxxxxx” and “M01xxxxxxx” in the “Clone:”.
  • Link of the parental sequence but not the Entry Clone is indicated in the “Accession” column. Please e-mail us for a junction of insert-vector sequence of Entry Clone.
  • The name of vector appears in “Vector:”. Please confirm the name of vector.

Please use the following site to obtain nucleotide sequense.
http://getentry.ddbj.nig.ac.jp/top-e.html
Information for the backbone vectors is HERE.

Order Forms and Material Transfer Agreement (MTA)

Obtain FormA.

  • Order Form and application of the payment by credit card.
    Click here for details.
  • Registration and downloading Order Form (Payment by Credit card).
    Open a new window!!
  • Order Form and application of the payment by bank transfer and check.
  • Downloading Order Form (Payment by Bank transfer or Check).
    Open a new window!!

Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).

Forms Description Form Download
Form C Material Transfer Agreement We request a signature of an authorized representative of a recipient institution. In the the Section 2(a), please write your purpose of use of clone in 10 to 20 words. PDF: 93 KB
Limited Use Label License: No.19 (GatewayR Cloning Products) Please download and read the Ordering Form and Label License No. 19. PDF: 13 KB

Address for orders

Please complete one copy of Form A and two copies of Form C and send them to the Gene Engineering Division by post or e-mail. In case sending them by e-mail, please send us the originals by post afterwards.
We look forward to receiving your order.

Gene Engineering Division, RIKEN BioResource Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
If you are not sure that you have completed forms correctly, please send them to us by e-mail or fax we will check them for you.
E-mail: dnabank.brc@riken.jp
Fax: (+81)-29-836-9120

 

Payment and charges

An INVOICE will be sent to you or your designated billing address. Prompt payment will be most appreciated. Please refer to the following page for more details:
http://dna.brc.riken.jp/en/orderingen
RIKEN requests all applicants to cover all bank charges, (including exchange, commission and handling fees) incurred in sending payment for resources you have ordered.

Notice of Citations

When publishing, in scientific journals, the results of research involving the use of materials from RIKEN BRC, please be sure to cite the paper designated by the depositor as well as to mention that these materials were provided by RIKEN BRC as follows: (name of BIOLOGICAL RESOURCE) was provided by the RIKEN BRC through the National Bio-Resource Project of the MEXT, Japan.

To contact us

  • Address: Gene Engineering Division, RIKEN BioResource Center, 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074 Japan
  • E-mail: dnabank.brc@riken.jp
  • Fax: (+81)-29-836-9120

Announcement

Life Technologies Corporation signs license agreement with RIKEN BioResource Center

  • The Life Technologies Corporation (formerly Invitrogen IP Holdings, Inc.) and the RIKEN BioResource Center signed a license agreement on July 2, 2009. Thanks to the generosity of the Life Technologies Corporation, the RIKEN BRC is now able, under this agreement, to receive, maintain, replicate and distribute GatewayR Entry clones and Expression clones for not-for-profit academic research.(more…)

(GatewayR is a registered trademark of Invitrogen.)

Nucleotide Sequences of Vectors

For maps, lease visit the MGC and I.M.A.G.E.

Vector Seq File & Primers Link to PlasmID Repository
(for nucleotide sequence)
pBluescriptR Primer A: T7 GTAATACGACTCACTATAGGGC
Primer B: Reverse2 GCGGATAACAATTTCACACAGG
[link]
pCMV-SPORT6 Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCMV-SPORT6.1 Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCMV-SPORT6.ccdb Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCR4-TOPO Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: Reverse2 GCGGATAACAATTTCACACAGG
[link]
pDONR221 Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: T7 TAATACGACTCACTATAGGG
[link]
pDNR-Dual [link]
pDNR-LIB Primer A: T7 TAATACGACTCACTATAGGG
Primer B: M13 Reverse AAACAGCTATGACCATGTTCA
[link]
pENTR/D-TOPO Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: T7 TAATACGACTCACTATAGGG
[link]
pOTB7
(pBR322 ori)
Primer A: pOTB7_F(7-32) AACGCGGCTACAATTAATACATAACC
Primer B: pOTB7_R(358-335) GTACTGCAGCCGATTCATTAATGC
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]

 

go to Head

(T.M. 2010.12.02)

2017.10.30