Clone Search


Resources for

Clontech Laboratories, Inc. and RIKEN BioResource Research Center concluded license agreement on preservation and distribution of Fluorescent Proteins, DsRed2 and mCherry for academic use

Clones & Vectors for Gene Expression
  Promoter collection
  Epitope tag fusion clones
  SEREX cDNA clone
  HLA antigen cDNA clone
  Nakamura & White RFLP clone

Resources for Gene Analysis
  Cultured microbe
  Cultured animal cell
  Experimental animal
  in vitro experiment
  Plant gene resources

Clone Set & Library
  Genomic clone
  cDNA clone
  Expression clone

Recombinant Virus
  Recombinant Adenovirus
  Shuttle Vector for Recombinant Virus

Genomic DNA
  JCM Microbial Genomic DNA
  BRC Mouse Genomic DNA

Search for resources
  Key word search
  Depositors List
  Gene Set Collection

BRC News

C57BL/6N (B6N) mouse BAC clone

General Information

The Gene Engineering Division has constructed a BAC library of the B6N substrain and the RIKEN BioResource Research Center accomplished BAC end sequencing of B6N and register the sequence data with DDBJ in a collaboration with the National Institute of Genetics under the Genome Information Upgrading Program of MEXT NBRP. The B6N Mouse BAC library consisted of 128,000 clones representing 90.2% of actual coverage of haploid genome.
The germ cell competent C57BL/6N ES cell lines are available from the Cell Engineering Division of RIKEN BRC.

Forms for Distribution

Please find ID of individual clone(s) using the Mouse BAC browser.
Mouse BAC browser B6N BAC
(open in a new window)

Forms required

Forms Description
Form A Order Form
Specify ID of clone(s) ex. B6Ng01-122P06 in the Name of clone column.
Leave Catalog no. column empty.
Complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express and others).
Form C Material Transfer Agreement
We would like to ask a signature of the Authorized Representative of a recipient institution.Indicate “NBRP B6N mouse BAC clone” as the BIOLOGICAL RESOURCE.

In the the Section 2(a), please write your purpose of use of clone in 10 to 20 words.

Please put in the terms and condisions (Section 4) that
“In publishingthe research results to be obtained by use of the B6N mouse BAC clone, an acknowledgment to the RIKEN BioResource Research Center is requested.”

Order Form (FormA) [Open a new window!!]
Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
NOTE: User registration on our system is required before download the Order Form for credit card (Visa / Master).
Material Transfer Agreement (Category I MTA) [PDF]
For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.

We ask a signature of the Authorized Representative of a recipient institution.
In the Section 2(a), please write your purpose of use of clone in 10 to 20 words.

(Please e-mail to to obtain MTA in MS-Word format)
Material Transfer Agreement (Category II MTA) [PDF]
For the use of our bioresource in research for the following cases:
 1. For research to be conducted by for-profit organizations.
 2. For collaborative research between for-profit organization and not-for-profit organization.
 3, For research by not-for- organization outsourced and sponsored by for-profit organization.
 4. For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center,
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
Fax: (+81)-29-836-9120
e-mail: (Please e-mail us to ask MTA in MS-Word format)

Further information for sale.

Distribution fee per clone:
8,640 YEN (For use in research for not-for-profit academic purpose).
17,280 YEN (For use in research for-profit-research purpose).
(Shipping cost is not included.)

For details for fee and payment, please visit Here [link].
Personal data protection policy

For protection of personal data at RIKEN BioResource Research Center, please reffer Personal data protection policy.

  • B6N mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.


Data Sheet

C57BL/6N (B6N) mouse BAC clone
Strain information
Species Mus musculus domesticus
Strain C57BL/6NCrlCrlj, male
Clone information
Vector pBACe3.6 (Cmr, U80929), EcoRI site
Insert EcoRI partial digestion
Host DH10B, E. coli
Sequence primers 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC
3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC
Nucleotide Sequences DNA Databank of Japan (DDBJ),
DH839446 to DH961576, and
GA000001 to GA131507
Total number of clones 128,007
Actual Genome Coverage ca. 90.2%

Related Information

Please visit Information site

  • Articles Published by Using This Materials
  • References and tips
  • Related products

NIG Mouse Genome Database

(T.M. 2010.05.06)
