BioResource Center  
RIKEN BRC DNA BANK
Home   DNA Resources   How to Order   Deposit   Technical Notes   Information

  Top Page >  Clone Collection > 

  NRCD Human (ja)   NRCD Human (en)   Data Sheet

NRCD Human Full-Length cDNA Clone

Available Clones

List of available clones

Obtain data of individual clone.
Plate Row Column 
- -

Keyword search

Browsing

Download data file

Step 1. Searching HP ID (using Table 1)

  • Download Table 1.
  • Using the Table 1, please seek an HP ID of your concerning gene. Table 1 contains 7,067 genes in these library. HP ID is an identifier given by the Depositor.
  • According to the Entrez Gene Database of the NCBI, Gene Symbol, Gene ID, Protein Name, RefSeq accession number, length of mRNA, location on the human chromosome and UniGene ID are included in this table. Number of full-length clones in AR and RB libraries are also indicated.
Step 2. Searching Clone ID (using Table 2)
  • Download Table 2 (NRCDhumclone.xls).
  • Using Table 2, please seek clones with the HP ID obtained in Table 1. In many case, you may find two or more clones with the same HP ID.
  • In the Table 2, Clone ID, Name of Vector, Nucleotide Accession Number of DDBJ/EMBL/GenBank (if available) and 60 bp of 5' terminal sequence of the cDNA is included. The nucleotide sequence also contains additional G and a short fragment of vector (indicated with blue font in the Table 2) in some cases.

Source of RNA:
AR Library: human retinal pigment epithelium cell line, ARPE-19 (CRL-2302, ATCC)
RB Library: human retinoblastoma cell line, Y79 (HTB-18, ATCC)


Vector Backbone:
The following vectors derived from pKA1 (Kato, S. et al, 1994)
pKA1U5 (accession no. AB191256 (map), Kato, S. et al., 2005)
pGCAP1 (accession no. AB191257 (map), Kato, S. et al., 2005)
pGCAP10 (accession no. AB371573 (map), Oshikawa, M. et al., 2008)


Sequence Primers:
Name of Primer Sequence
pGCAP_F 5'- CTCAGTGGATGTTGCCTTTAC -3'
pGCAP_R 5'- GCATTCTAGTTGTGGTTTGTCC -3'

Submitted Nucleotide Sequences
Accession numbers Reference
AB191258-AB191264 DNA Res. 12: 53-62 (2005)
AB371430-AB371572
AB371574-AB371588
DNA Res. 15: 123-136 (2008)
AB448735-AB448737 Mol. Vis. 15: 482-494 (2009)
AB593010-AB593186
AB621803-AB621830
Invest Ophthalmol Vis Sci. 52: 6662-6670 (2011)

References

  1. Kato, S., Sekine, S., Oh S., Kim, N., Umezawa, Y., Abe, N., Yokoyama-kobayashi, M., Aoki, T. Construction of human full-length cDNA bank. Gene 150, 243-250, 1994.
    http://www.sciencedirect.com/science/article/pii/0378111994904332
  2. Kato S, Ohtoko K, Ohtake H, Kimura T. Vector-capping: a simple method for preparing a high-quality full-length cDNA library. DNA Res. 12 (1), 53-62, 2005.
    http://dnaresearch.oxfordjournals.org/content/12/1/53.long
  3. Kato S, Oshikawa M, Ohtoko K. Full-length transcriptome analysis using a bias-free cDNA library prepared with the vector-capping method. Methods Mol Biol. 729, 53-70, 2011.
    http://www.springerlink.com/content/v167171110r03558/#section=864398&page=1
  4. Oshikawa M, Sugai Y, Usami R, Ohtoko K, Toyama S, Kato S. Fine expression profiling of full-length transcripts using a size-unbiased cDNA library prepared with the vector-capping method. DNA Res. 15 (3), 123-136, 2008.
    http://dnaresearch.oxfordjournals.org/content/15/3/123.long
  5. Oshikawa M, Tsutsui C, Ikegami T, Fuchida Y, Matsubara M, Toyama S, Usami R, Ohtoko K, Kato S. Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest Ophthalmol Vis Sci. 52 (9), 6662-6670, 2011.
    http://www.iovs.org/content/52/9/6662.abstract

go to Head

(T.M. 2011.07.25)

2014.10.18