BioResource Center RIKEN BRC DNA BANK
  Home   Clone set   Gene Expression   Gene Analysis   Search   Literature

BAC Clone Set

  MSM/Ms   C57BL/6N (B6N)   Rat (Rattus norvegicus)   Japanese Macaque   BAC DNA Preparation

NBRP Rat (Rattus norvegicus) genome BAC clone

  Rat BAC (ja)   Rat BAC (en)   Data Sheet

Data Sheet

1.RDB 6273NBRP rat BAC clone RNB1
1.1Strain information
SpeciesRattus norvegicus
StrainF344/Stm
1.2Clone information
VectorpKS145 (Ampr, AB013921 (map)), SacI site
Sequencing PrimerAFF, 5'- TTCCCAGTCACGACGTTGTA -3', 5' primer, 106 to 87 of AB013921.
 AFR, 5'- GGAATTGTGAGCGGATAACAA -3', 3' primer, 7466 to 7486 of AB013921.
InsertSacI partial digestion
HostDH10B, E. coli
Nucleotide sequencesDNA Databank of Japan (DDBJ), DH508174-DH839445
Rattus_norvegicus_GSS_080325_1.seq.gz (331,272 entries),
ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/
Total number of clones
(384-well plate)		RNB1, ca. 238,000 clones (620 plates)
Average length116 kb
1.3Reference
1 The STAR Consortium, SNP and haplotype mapping for genetic analysis in the rat. Nat. Genet. 40, 560-566, 2008.
2 NBRP Rat http://www.anim.med.kyoto-u.ac.jp/nbr/
3 Rat Genome Database

1.RDB 6274NBRP rat BAC clone RNB2
1.1Strain information
SpeciesRattus norvegicus
StrainLE/Stm
1.2Clone information
VectorpKS145 (Ampr, AB013921 (map)), SacI site
Sequencing PrimerAFF, 5'- TTCCCAGTCACGACGTTGTA -3', 5' primer, 106 to 87 of AB013921.
 AFR, 5'- GGAATTGTGAGCGGATAACAA -3', 3' primer, 7466 to 7486 of AB013921.
InsertSacI partial digestion
HostDH10B, E. coli
Nucleotide sequencesDNA Databank of Japan (DDBJ), FT000001-FT227486
Rattus_norvegicus_GSS_090401_1.seq.gz (227,486 entries),
ftp://ftp.ddbj.nig.ac.jp/ddbj_database/mass/Rattus_norvegicus_GSS/Rattus_norvegicus_GSS_090401_1.seq.gz
Total number of clones
(384-well plate)		RNB2, ca. 260,000 clones (677 plates)
Average length129 kb
1.3Reference
1 The STAR Consortium, SNP and haplotype mapping for genetic analysis in the rat. Nat. Genet. 40, 560-566, 2008.
2 NBRP Rat http://www.anim.med.kyoto-u.ac.jp/nbr/
3 Rat Genome Database

Articles Published by Using This Materials

  • Yamamoto S, Nakata M, Sasada R, Ooshima Y, Yano T, Shinozawa T, Tsukimi Y, Takeyama M, Matsumoto Y, Hashimoto T. (2011) Derivation of rat embryonic stem cells and generation of protease-activated receptor-2 knockout rats. Transgenic Res. 2011 Oct 15. [Epub ahead of print]

Related article

Related products


go to Head

2013.04.13