Home   Clone set   Gene Expression   Gene Analysis   Search   Literature  
BioResource Center RIKEN BRC DNA BANK

cDNA Cloned Library

 Genome Network Project Human cDNA Clones

  Outline (ja)   Outline (en)   Vector Information
Plate Row Column 
- -
    
Find Clones in the A to Z List.
Go to

Nucleotide Sequences of Vectors

For maps, lease visit the MGC and I.M.A.G.E.

VectorSeq File & PrimersLink to PlasmID Repository
(for nucleotide sequence)
pBluescriptR Primer A: T7 GTAATACGACTCACTATAGGGC
Primer B: Reverse2 GCGGATAACAATTTCACACAGG
[link]
pCMV-SPORT6 Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCMV-SPORT6.1 Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCMV-SPORT6.ccdb Primer A: Reverse2 GCGGATAACAATTTCACACAGG
Primer B: M13 GTTTTCCCAGTCACGACGTTGTA
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]
pCR4-TOPO Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: Reverse2 GCGGATAACAATTTCACACAGG
[link]
pDONR221 Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: T7 TAATACGACTCACTATAGGG
[link]
pDNR-Dual  
 
[link]
pDNR-LIB Primer A: T7 TAATACGACTCACTATAGGG
Primer B: M13 Reverse AAACAGCTATGACCATGTTCA
[link]
pENTR/D-TOPO Primer A: M13 GTTTTCCCAGTCACGACGTTGTA
Primer B: T7 TAATACGACTCACTATAGGG
[link]
pOTB7
(pBR322 ori)
Primer A: pOTB7_F(7-32) AACGCGGCTACAATTAATACATAACC
Primer B: pOTB7_R(358-335) GTACTGCAGCCGATTCATTAATGC
Primer C: TTTTTTTTTTTTTTTTTTTTNNN
[link]

go to Head

(T.M. 2010.12.02)

2015.04.21