MSM/Ms mouse BAC clone

General Information

MSM/Ms Mouse BAC deposited by Dr. Kuniya Abe, RIKEN BRC; Mus musculus molossinus genomic DNA consists of 200,000 BAC clones. Individual clones are available.

Individual clone ID can be get on the Mouse BAC browser.
Instruction: Searching BAC clone by the BAC browserB6N BAC

Ordering information

Forms

Forms Description
Form A Order Form Please specify ID of clone(s) ex. MSMg01-045A01.
Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express and others).
Form C Material Transfer Agreement We would like to ask a signature of the Authorized Representative of a recipient institution.
Please indicate “NBRP MSM/Ms mouse BAC clone” as the BIOLOGICAL RESOURCE.
Please put in the terms and condisions (Section 4) that “In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested (Abe et al., 2004, Genome Res. 14: 2439-2447).” (Please e-mail to dnabank.brc@riken.jp to obtain MTA in MS-Word format)
Order Form:
Please complete the form with your shipping information including your account number of an international courier
(FedEx. World Courier, TNT Express, DHL Global Forwarding and others).
See detail in Information of Request for Distribution

Note:
The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] 
Order Form for Bank Transfer Payment. [Word] 

Material Transfer Agreement (Category I MTA) [Word]

For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
  • Regarding Section 2(a):
    Please write your research purpose in detail. We need description specifically how and for what purpose you are going to use the DNA Bank resource(s). If the information is considered insufficient, we may ask you to add more or rewrite it.
    We can check whether the documents are filled out correctly or not in advance. Please email documents to us.
  • Regarding signature line:
    "Authorized Representative" is a person who is responsible for intellectual property rights. We request that the candidate is in one of the following positions, he/she can sign the MTA as the Authorized Representative. For anything unclear, please contact us by email.
    • College/University/Graduate School: President, Dean, Director or Head of Department
    • Research Institution: Director
    • Corporation: President, CEO, Director
    • Any officer appointed as Intellectual Property Administrator by the organization
    The MTA is a formal contract to be executed between institutions. Therefore, we ask your Authorized Representative to be an authority listed above.
Material Transfer Agreement (Category II MTA) [Word]

For the use of our bioresource in research for the following cases:
  • For research to be conducted by for-profit organizations.
  • For collaborative research between for-profit organization and not-for-profit organization.
  • For research by not-for- organization outsourced and sponsored by for-profit organization.
  • For for-profit research by not-for-profit organization including R&D with the aim of patent acquisition.

Send forms:

The DNA Bank, RIKEN BioResource Research Center (BRC),
3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan
E-mail: dna_sec.brc@riken.jp
FAX: (+81)-29-836-9120

Please visit further information of distribution and fees.
Distribution fee per clone (as of April 1st, 2023):
JPY 9,460 (For use in research for not-for-profit academic purpose).
JPY 18,920 (For use in research for-profit-research purpose).
  • The cost of shipping containers, dry ice (if required) and freight will be charged separately. These are not included in the fee.
  • For details for fee and payment, please visit Information of Request for Distribution.

Distribution information

  • MSM/Ms mouse BAC clone(s) is shipped as stab agar culture with 12.5 ug/mL chloramphenicol in an individual tube.
  • When you receive the plastic vial of stab culture, please streak the bacteria on an LB agar plate containing 12.5 ug/mL chloramphenicol. We hope you can find colonies.
  • When you streak bacteria, please take bacteria from the middle part of stab agar medium but not those from the surface of the stab which are not really healthy.
  • The vial should be placed in a refrigerator (4 C degree) but not in a freezer. Stab culture is not meant to be for frozen storage of bacteria.
  • Please refer BAC Related Information for further information.

Related Information

data sheet

Data Sheet

MSM/Ms mouse BAC clone
Strain information
Species Mus musculus molossinus
Strain MSM/Ms
Group Wild mouse-derived strains
Mus musculus molossinus (M.MOL-MSM)
Year 1978
Origin Mishima, Shizuoka
Generation F56+9
Clone information
Vector pBACe3.6 (Cmr, U80929), EcoRI site
Insert EcoRI partial digestion
Host DH10B, E. coli
Sequence primers 5′ sequence by T7 primer: TGACATTGTAGGACTATATTGC

3′ sequence by TJ primer: ATCTGCCGTTTCGATCCTCC

Nucleotide sequences DNA Databank of Japan (DDBJ), AG275743 to AG613213
Total number of clones (384-well plate) version 1, ca. 110,000 clones (288 plates)

version 2, ca. 110,000 clones (288 plates)

Average length and coverage 125 kb, 10 times (ca. 90%) genome coverage

Reference

  • Reference of this BAC: Abe K, Noguchi H, Tagawa K, Yuzuriha M, Toyoda A, Kojima T, Ezawa K, Saitou N, Hattori M, Sakaki Y, Moriwaki K, Shiroishi T. (2004) Contribution of Asian mouse subspecies Mus musculus molossinus to genomic constitution of strain C57BL/6J, as defined by BAC-end sequence-SNP analysis. Genome Res. 14 (12): 2439-2447 (2004). PMID: 15574823
  • MSM/Ms BAC Information site
    • Articles Published by Using This Materials
    • References and tips
  • NIG_MoG2, the NIG Mouse Genome database
  • Genome Browser Gateway, UCSC
  • Please visit Informaion site for articles published by using this materials, references and tips.

(GRP0039e 2004.06.14 T.M.)

2021.11.18



Comments are closed.