Firefly Luciferase Construct

List of Construct

The Promoter series were validated by restriction enzyme digestion and confirmation of end sequences of insert DNA.

Sequencing Primer
pGL4-4174F: TAGCAAAATAGGCTGTCCCC
pGL4-136R: CTTCGAGTGGGTAGAATGGC

‘Activity’ indicates a value of the fold induction compared with empty vector.
-, less than 2
+, 2 to 5
++, 5 to 10
actual value, more than 10

Locus symbol Catalog No. Name of clone Size of PCR amplified DNA Activity in Results (pdf)
HeLa HepG2 Hep3B
Control vector pGL3 Control 372.4 159.9 226.6
ABCA1 RDB07680 pGL4-phABCA1 cloned fragment: 104929286 to 104928133(NC_000009.12); relatively -1117 to +37, where +1 corresponds to 1 nt of NM_005502.4 63.5 51 11.3 [pdf]
ABCB1 RDB07315 pGL4-phABCB1 cloned fragment: 87714385 to 87713167(NC_000007.14); relatively -1062 to +157, where +1 corresponds to 1 nt of NM_001348945.1 + [pdf]
ADM RDB07808 pGL4-phADM cloned fragment: 10303763 to 10305239(NC_000011.10 ); relatively -1310 to +167, where +1 corresponds to 1 nt of NM_001124.3 588.5 55.5 50.2 [pdf]
ADRB2 RDB07532 pGL4-phADRB2 cloned fragment: 148825201 to 148826646(NC_000005.10); relatively -1392 to +54, where +1 corresponds to 1 nt of NM_000024.5 161 119 21.5 [pdf]
AGT RDB07683 pGL4-phAGT cloned fragment: 230716077 to 230714584(NC_000001.11); relatively -1955 to -461, where +1 corresponds to 1 nt of NM_000029.4 [pdf]
AHR RDB07724 pGL4-phAHR cloned fragment: 17297271 to 17298730(NC_000007.14); relatively -1381 to +79, where +1 corresponds to 1 nt of NM_001621.5 225.3 67.8 49.6 [pdf]
AIFM2 RDB07332 pGL4-phAIFM2 cloned fragment: 70134069 to 70132792(NC_000010.11); relatively -1135 to +143, where +1 corresponds to 1 nt of NM_001198696.1 105 268 177 [pdf]
AKT1 RDB07331 pGL4-phAKT1 cloned fragment: 104794722 to 104793571(NC_000014.9); relatively -1121 to +31, where +1 corresponds to 1 nt of NM_005163.2 + + [pdf]
ALB RDB07818 pGL4-phALB cloned fragment: 73402814 to 73404284(NC_000004.12); relatively -1473 to -2, where +1 corresponds to 1 nt of NM_000477.7 + + [pdf]
ALDOA RDB07512 pGL4-phALDOA cloned fragment: 30051970 to 30053201(NC_000016.10); relatively -1120 to +112, where +1 corresponds to 1 nt of NM_000034.3 15.5 80.4 13.7 [pdf]
ANTXR1 RDB07333 pGL4-phANTXR1 cloned fragment: 69012220 to 69013408(NC_000002.12); relatively -924 to +265, where +1 corresponds to 1 nt of NM_032208.2 88.5 30 36 [pdf]
APAF1 RDB07316 pGL4-phAPAF1 cloned fragment: 98644170 to 98645321(NC_000012.12); relatively -1130 to +22, where +1 corresponds to 1 nt of NM_013229.2 31 101 43 [pdf]
APCS RDB07317 pGL4-phAPCS cloned fragment: 159586692 to 159587854(NC_000001.11); relatively -1134 to +29, where +1 corresponds to 1 nt of NM_001639.4 + + + [pdf]
APEX1 RDB07729 pGL4-phAPEX1 cloned fragment: 20453836 to 20455295(NC_000014.9); relatively -1390 to +70, where +1 corresponds to 1 nt of NM_001641.4 216.5 99 67.8 [pdf]
APOA1 RDB07684 pGL4-phAPOA1 cloned fragment: 116839091 to 116837607(NC_000011.10 ); relatively -1141 to +344, where +1 corresponds to 1 nt of NM_000039.2 ++ 144 + [pdf]
APOB RDB07527 pGL4-phAPOB cloned fragment: 21045468 to 21044033(NC_000002.12); relatively -1395 to +41, where +1 corresponds to 1 nt of NM_000384.3 14.5 + [pdf]
APOC3 RDB07303 pGL4-phAPOC3 cloned fragment: 116829078 to 116830062(NC_000011.10); relatively -829 to +156, where +1 corresponds to 1 nt of NM_000040.3 + 158 33 [pdf]
APOE RDB07556 pGL4-phAPOE cloned fragment: 44904368 to 44905816(NC_000019.10); relatively -1428 to +21, where +1 corresponds to 1 nt of NM_001302688.2 88.3 ++ ++ [pdf]
APP RDB07692 pGL4-phAPP cloned fragment: 26172063 to 26170592(NC_000021.9); relatively -1293 to +179, where +1 corresponds to 1 nt of NM_000484.4 ++ + + [pdf]
AQP3 RDB07311 pGL4-phAQP3 cloned fragment: 33448723 to 33447505 (NC_000009.12); relatively -1090 to +129, where +1 corresponds to 1nt of NM_004925.4 19 17 93.3 [pdf]
AR RDB07690 pGL4-phAR cloned fragment: 67542821 to 67544310(NC_000023.11); relatively -1802 to -312, where +1 corresponds to 1 nt of NM_000044.4 19.3 ++ ++ [pdf]
ARNT RDB07731 pGL4-phARNT cloned fragment: 150878102 to 150876641(NC_000001.11); relatively -1503 to -41, where +1 corresponds to 1 nt of NM_001668.4 and relatively -1392 to +70, where +1 corresponds to 1 nt of XM_005245151.2 203 214.3 191.8 [pdf]
ASNS RDB07305 pGL4-phASNS cloned fragment: 97873685 to 97872433(NC_000007.14); relatively -1399 to -146, where +1 corresponds to 1 nt of NM_133436.3 and relatively -1156 to +97, where +1 corresponds to 1 nt of NM_001673.5 1104 254 6536.7 [pdf]
ATF2 RDB07712 pGL4-phATF2 cloned fragment: 175169601 to 175168132(NC_000002.12); relatively -1398 to +72, where +1 corresponds to 1 nt of NM_001880.4 140 82.8 67.6 [pdf]
ATF3 RDB07710 pGL4-phATF3 cloned fragment: 212607207 to 212608688(NC_000001.11); relatively -1554 to -72, where +1 corresponds to 1 nt of NM_001674.4 40 54.5 43.3 [pdf]
ATR RDB07334 pGL4-phATR cloned fragment: 142579948 to 142578802(NC_000003.12); relatively -1215 to -68, where +1 corresponds to 1 nt of NM_001184.4 105.5 408 308 [pdf]
B2M RDB07479 pGL4-phB2M cloned fragment: 44710090 to 44711509(NC_000015.10); relatively -1427 to -7, where +1 corresponds to 1 nt of NM_004048.3 and relatively -1402 to +18, where +1 corresponds to 1 nt of XM_005254549.3 339.5 ++ + [pdf]
BAI1 RDB07401 pGL4-phBAI1 cloned fragment: 142462682 to 142464049(NC_000008.11); relatively +12979 to +14347, where +1 corresponds to 1 nt of NM_001702.3 and relatively -1333 to +35, where +1 corresponds to 1 nt of NM_001702.2 + + + [pdf]
BAK1 RDB07318 pGL4-phBAK1 cloned fragment: 33581433 to 33580241(NC_000006.12); relatively -1157 to +36, where +1 corresponds to 1 nt of NM_001188.4 22 91 34 [pdf]
BCL2 RDB07567 pGL4-phBCL2 cloned fragment: 63320698 to 63319352(NC_000018.10); relatively -1318 to +29, where +1 corresponds to 1 nt of NM_000633.2 21 ++ ++ [pdf]
BCL2L1 RDB07335 pGL4-phBCL2L1 cloned fragment: 31724021 to 31722808(NC_000020.11); relatively -1117 to +97, where +1 corresponds to 1 nt of NM_138578.3 ++ 56 147 [pdf]
BRCA1 RDB07296 pGL4-phBRCA1 cloned fragment: 43,125,397 to 43,126,526 (NC_000017.11); relatively -1.0 kb to +87, where +1 corresponds to 1 nt of NM_007294.3 44.5 42 238 [pdf]
BRCA2 RDB07691 pGL4-phBRCA2 cloned fragment: 32,314,131 to 32,315,604 (NC_000013.11); relatively -1.3 kb to +125, where +1 corresponds to 1 nt of NM_000059.3 48 22 49.9 [pdf]
BTG2 RDB07402 pGL4-phBTG2 cloned fragment: 203304202 to 203305557(NC_000001.11); relatively -1334 to +22, where +1 corresponds to 1 nt of NM_006763.3 285 1162 271 [pdf]
C12orf5 RDB07414 pGL4-phC12orf5 cloned fragment: 4319879 to 4321213(NC_000012.12); relatively -1334 to +1, where +1 corresponds to 1 nt of NM_020375.3 63 234 138 [pdf]
CABLES1 RDB07337 pGL4-phCABLES1 cloned fragment: 23154667 to 23155888(NC_000018.10); relatively -1158 to +64, where +1 corresponds to 1 nt of NM_138375.2 + [pdf]
CALCA RDB07291 pGL4-phCALCA cloned fragment: 14973573 to 14972253(NC_000011.10); relatively -1222 to +99, where +1 corresponds to 1 nt of NM_001741.3 271 105 322 [pdf]
CASP1 RDB07338 pGL4-phCASP1 cloned fragment: 105036277 to 105035109(NC_000011.10); relatively -1133 to +36, where +1 corresponds to 1 nt of NM_033292.4 ++ 16 20 [pdf]
CAV1 RDB07364 pGL4-phCAV1 cloned fragment: 116523610 to 116524918(NC_000007.14); relatively -1175 to +134, where +1 corresponds to 1 nt of NM_001753.4 + + [pdf]
CCND1 RDB07299 pGL4-phCCND1 cloned fragment: 69639958 to 69641148(NC_000011.10); relatively -1147 to +44, where +1 corresponds to 1 nt of NM_053056.2 + 170 ++ [pdf]
CD44 RDB07685 pGL4-phCD44 cloned fragment: 35137703 to 35139162(NC_000011.10); relatively -1167 to +293, where +1 corresponds to 1 nt of NM_000610.3 ++ [pdf]
CD55 RDB07539 pGL4-phCD55 cloned fragment: 207320088 to 207321519(NC_000001.11); relatively -1590 to -158, where +1 corresponds to 1 nt of NM_000574.5 ++ + + [pdf]
CD82 RDB07416 pGL4-phCD82 cloned fragment: 44564415 to 44565733(NC_000011.10); relatively -1248 to +71, where +1 corresponds to 1 nt of NM_002231.4 96.5 192 30.5 [pdf]
CDC2 RDB07816 pGL4-phCDC2 cloned fragment: 60777041 to 60778517(NC_000010.11); relatively -1437 to +40, where +1 corresponds to 1 nt of NM_001786.5 186 36.8 17.1 [pdf]
CDC25A RDB07709 pGL4-phCDC25A cloned fragment: 48189750 to 48188291(NC_000003.12); relatively -1333 to +127, where +1 corresponds to 1 nt of NM_001789.3 148.3 33.5 72.4 [pdf]
CDK4 RDB07907 pGL4-phCDK4 cloned fragment: 57753838 to 57752340(NC_000012.12); relatively -1528 to -29, where +1 corresponds to 1 nt of NM_000075.4 108.5 43.3 27.5 [pdf]
CDKN1A RDB07302 pGL4-phCDKN1A cloned fragment: 36677551 to 36678753(NC_000006.12); relatively -1128 to +75, where +1 corresponds to 1 nt of NM_000389.4 29 78 38 [pdf]
CEBPA RDB07812 pGL4-phCEBPA cloned fragment: 33303920 to 33302423(NC_000019.10); relatively -1356 to +142, where +1 corresponds to 1 nt of NM_001285829.1 66.5 33.5 35.1 [pdf]
CEBPE RDB07713 pGL4-phCEBPE cloned fragment: 23120684 to 23119221(NC_000014.9); relatively -1073 to +391, where +1 corresponds to 1 nt of NM_001805.3 + [pdf]
CGA RDB07456 pGL4-phCGA cloned fragment: 87096335 to 87095063(NC_000006.12); relatively -1229 to +44, where +1 corresponds to 1 nt of NM_001252383.2 137 31 573.3 [pdf]
CHEK1 RDB07319 pGL4-phCHEK1 cloned fragment: 125625268 to 125626475(NC_000011.10); relatively +132 to +1340, where +1 corresponds to 1 nt of NM_001114122.2 and relatively -1088 to +120, where +1 corresponds to 1 nt of NM_001274.5 83.5 31 110 [pdf]
CHEK2 RDB07407 pGL4-phCHEK2 cloned fragment: 28743124 to 28741813(NC_000022.11); relatively -1290 to +22, where +1 corresponds to 1 nt of NM_007194.3 57 80 34 [pdf]
CHUK RDB07383 pGL4-phCHUK cloned fragment: 100230864 to 100229550(NC_000010.11); relatively -1268 to +47, where +1 corresponds to 1 nt of NM_001278.5 767 820 944 [pdf]
COL1A1 RDB07459 pGL4-phCOL1A1 cloned fragment: 50202872 to 50201613(NC_000017.11); relatively -1233 to +27, where +1 corresponds to 1 nt of NM_000088.3 240.5 ++ 10.8 [pdf]
CREM RDB07811 pGL4-phCREM cloned fragment: 35125718 to 35127179(NC_000010.11); relatively -1509 to -47, where +1 corresponds to 1 nt of NM_181571.3 and relatively -1391 to +71, where +1 corresponds to 1 nt of XM_011519324.2 195.5 110.5 120.8 [pdf]
CSF2 RDB07482 pGL4-phCSF2 cloned fragment: 132072406 to 132073823(NC_000005.10); relatively -1383 to +35, where +1 corresponds to 1 nt of NM_000758.4 ++ + [pdf]
CSNK2A1 RDB07483 pGL4-phCSNK2A1 cloned fragment: 545209 to 543808(NC_000020.11); relatively -1419 to -17, where +1 corresponds to 1 nt of NM_177559.3 94 64 78.3 [pdf]
CTGF RDB07807 pGL4-phCTGF cloned fragment: 131952827 to 131951335(NC_000006.12); relatively -1455 to +38, where +1 corresponds to 1 nt of NM_001901.3 248.5 102.5 16.6 [pdf]
CX3CL1 RDB07340 pGL4-phCX3CL1 cloned fragment: 57371363 to 57372598(NC_000016.10); relatively -1127 to +109, where +1 corresponds to 1 nt of NM_002996.6 + [pdf]
CXCL12 RDB07687 pGL4-phCXCL12 cloned fragment: 44386542 to 44385073(NC_000010.11); relatively -1445 to +25, where +1 corresponds to 1 nt of NM_199168.4 21 27.3 14.3 [pdf]
CYP11A1 RDB07460 pGL4-phCYP11A1 cloned fragment: 74368927 to 74367710(NC_000015.10); relatively -1281 to -63, where +1 corresponds to 1 nt of NM_000781.3 + + [pdf]
CYP1A1 RDB07541 pGL4-phCYP1A1 cloned fragment: 74726956 to 74725495(NC_000015.10); relatively -1428 to +34, where +1 corresponds to 1 nt of NM_000499.5 590.7 43.8 33.5 [pdf]
DDC RDB07555 pGL4-phDDC cloned fragment: 50562516 to 50561019(NC_000007.14); relatively +2889 to +4387, where +1 corresponds to 1 nt of NM_001082971.2 and relatively -1445 to +53, where +1 corresponds to 1 nt of NM_000790.4 21.3 + [pdf]
DKK1 RDB07341 pGL4-phDKK1 cloned fragment: 52313141 to 52314306(NC_000010.11); relatively -1140 to +26, where +1 corresponds to 1 nt of NM_012242.4 20.5 35 44 [pdf]
DRAM RDB07412 pGL4-phDRAM cloned fragment: 101876102 to 101877447(NC_000012.12); relatively -1478 to -132, where +1 corresponds to 1 nt of NM_018370.3 and relatively -1340 to +6, where +1 corresponds to 1 nt of XM_005269004.2 59.5 62 15 [pdf]
DUSP1 RDB07368 pGL4-phDUSP1 cloned fragment: 172772338 to 172771174(NC_000005.10); relatively -1143 to +22, where +1 corresponds to 1 nt of NM_004417.4 173.8 176.8 1083.5 [pdf]
DUSP12 RDB07384 pGL4-phDUSP12 cloned fragment: 161748494 to 161749803(NC_000001.11); relatively -1274 to +36, where +1 corresponds to 1 nt of NM_007240.3 1593 1221 1937 [pdf]
E2F1 RDB07810 pGL4-phE2F1 cloned fragment: 33687850 to 33686378(NC_000020.11); relatively -1465 to +8, where +1 corresponds to 1 nt of NM_005225.3 63.5 ++ 10.6 [pdf]
E2F2 RDB07904 pGL4-phE2F2 cloned fragment: 23532436 to 23530968(NC_000001.11); relatively -1203 to +266, where +1 corresponds to 1 nt of NM_004091.4 32.5 + + [pdf]
E2F4 RDB07714 pGL4-phE2F4 cloned fragment: 67190703 to 67192172(NC_000016.10); relatively -1452 to +18, where +1 corresponds to 1 nt of NM_001950.4 891 289 317.1 [pdf]
EGFR RDB07398 pGL4-phEGFR cloned fragment: 55017912 to 55019251(NC_000007.14); relatively -1105 to +235, where +1 corresponds to 1 nt of NM_005228.5 31 26 65 [pdf]
EGR1 RDB07369 pGL4-phEGR1 cloned fragment: 138464340 to 138465649(NC_000005.10); relatively -1152 to +158, where +1 corresponds to 1 nt of NM_001964.3 1594.3 605 5730 [pdf]
ELK1 RDB07908 pGL4-phELK1 cloned fragment: 47652041 to 47650572(NC_000023.11); relatively -1437 to +33, where +1 corresponds to 1 nt of NM_001114123.2 58.5 31 20.9 [pdf]
EPCAM RDB07367 pGL4-phEPCAM cloned fragment: 47368067 to 47369577(NC_000002.12); relatively -1081 to +430, where +1 corresponds to 1 nt of NM_002354.2 28.5 [pdf]
EPHA2 RDB07342 pGL4-phEPHA2 cloned fragment: 16157210 to 16156048(NC_000001.11); relatively -1101 to +62, where +1 corresponds to 1 nt of NM_004431.4 26 152 81 [pdf]
ESR1 RDB07528 pGL4-phESR1 cloned fragment: 151806130 to 151807567(NC_000006.12); relatively -1549 to -111, where +1 corresponds to 1 nt of NM_000125.3 and relatively -1189 to +249, where +1 corresponds to 1 nt of NM_001122740.1 ++ + [pdf]
ETS1 RDB07819 pGL4-phETS1 cloned fragment: 128523650 to 128522176(NC_000011.10 ); relatively -1340 to +135, where +1 corresponds to 1 nt of NM_005238.4 82 36.3 16.1 [pdf]
EZH2 RDB07370 pGL4-phEZH2 cloned fragment: 148885505 to 148884301(NC_000007.14); relatively -1156 to +49, where +1 corresponds to 1 nt of NM_004456.4 ++ ++ 65.5 [pdf]
F3 RDB07458 pGL4-phF3 cloned fragment: 94542880 to 94541623(NC_000001.11); relatively -1023 to +235, where +1 corresponds to 1 nt of NM_001993.4 40 13 10 [pdf]
F8 RDB07519 pGL4-phF8 cloned fragment: 155024069 to 155022695(NC_000023.11); relatively -1346 to +29, where +1 corresponds to 1 nt of NM_000132.3 + [pdf]
FAS RDB07349 pGL4-phFAS cloned fragment: 88989317 to 88990647(NC_000010.11); relatively -1481 to -150, where +1 corresponds to 1 nt of NM_000043.6 and relatively -1242 to +89, where +1 corresponds to 1 nt of NR_028033.3 + ++ [pdf]
FDXR RDB07385 pGL4-phFDXR cloned fragment: 74874305 to 74872957(NC_000017.11); relatively -1274 to +75, where +1 corresponds to 1 nt of NM_024417.4 756 2295 921 [pdf]
FLT1 RDB07726 pGL4-phFLT1 cloned fragment: 28496434 to 28494969(NC_000013.11); relatively -1306 to +160, where +1 corresponds to 1 nt of NM_002019.4 82 10.5 ++ [pdf]
FOS RDB07292 pGL4-phFOS cloned fragment: 75277609 to 75278869(NC_000014.9); relatively -1169 to +92, where +1 corresponds to 1 nt of NM_005252.4 213 180 150 [pdf]
FOSL1 RDB07476 pGL4-phFOSL1 cloned fragment: 65901742 to 65900422(NC_000011.10); relatively -1354 to -33, where +1 corresponds to 1 nt of NM_005438.5 and relatively -1216 to +105, where +1 corresponds to 1 nt of NR_125339.1 12.5 ++ ++ [pdf]
GADD45A RDB07320 pGL4-phGADD45A cloned fragment: 67684030 to 67685254(NC_000001.11); relatively -1171 to +54, where +1 corresponds to 1 nt of NM_001924.4 214.5 675 313 [pdf]
GADD45B RDB07529 pGL4-phGADD45B cloned fragment: 2474664 to 2476169(NC_000019.10); relatively -1463 to +43, where +1 corresponds to 1 nt of NM_015675.4 2122.7 268.5 132.5 [pdf]
GH2 RDB07309 pGL4-phGH2 cloned fragment: 63919971 to 63881830(NC_000017.11); relatively -38027 to +115, where +1 corresponds to 1 nt of NM_002059.5 92 12 90 [pdf]
GJA1 RDB07538 pGL4-phGJA1 cloned fragment: 121434391 to 121435646(NC_000006.12); relatively -1186 to +70, where +1 corresponds to 1 nt of NM_000165.5 16.4 ++ ++ [pdf]
GLI1 RDB07902 pGL4-phGLI1 cloned fragment: 57458742 to 57460211(NC_000012.12); relatively -1043 to +427, where +1 corresponds to 1 nt of NM_005269.3 and relatively -1396 to +74, where +1 corresponds to 1 nt of XM_011538190.2 + + + [pdf]
GML RDB07371 pGL4-phGML cloned fragment: 142833526 to 142834833(NC_000008.11); relatively -1275 to +33, where +1 corresponds to 1 nt of NM_002066.3 + ++ [pdf]
GSTP1 RDB07477 pGL4-phGSTP1 cloned fragment: 67582608 to 67583850(NC_000011.10); relatively -987 to +256, where +1 corresponds to 1 nt of NM_000852.3 93 294.4 99.2 [pdf]
HDAC1 RDB07484 pGL4-phHDAC1 cloned fragment: 32290713 to 32292183(NC_000001.11); relatively -1370 to +101, where +1 corresponds to 1 nt of NM_004964.3 42 156 141.3 [pdf]
HIF1A RDB07693 pGL4-phHIF1A cloned fragment: 61694082 to 61695550(NC_000014.9); relatively -1431 to +38, where +1 corresponds to 1 nt of NM_001530.4 15.3 25.3 33 [pdf]
HIST2H2AB RDB07909 pGL4-phHIST2H2AB cloned fragment: 119096856 to 119095396(NC_000011.10 ); relatively -1389 to +72, where +1 corresponds to 1 nt of NM_002105.2 2425 100.8 102.3 [pdf]
HLA-DQB1 RDB07557 pGL4-phHLA-DQB1 cloned fragment: 32668102 to 32666641(NC_000006.12); relatively -1445 to +17, where +1 corresponds to 1 nt of NM_002123.5 30.7 10.5 ++ [pdf]
HLA-DRA RDB07389 pGL4-phHLA-DRA cloned fragment: 32438507 to 32439912(NC_000006.12); relatively -1380 to +26, where +1 corresponds to 1 nt of NM_019111.5 44 + ++ [pdf]
HLA-E RDB07388 pGL4-phHLA-E cloned fragment: 30488374 to 30489534(NC_000006.12); relatively -1135 to +26, where +1 corresponds to 1 nt of NM_005516.6 134 75 453.3 [pdf]
HMOX1 RDB07485 pGL4-phHMOX1 cloned fragment: 35,379,656 to 35,381,125 (NC_000022.11); relatively -1,440 to +30, where +1 corresponds to 1 nt of NM_002133.3 45.5 ++ ++ [pdf]
HNF4A RDB07534 pGL4-phHNF4A cloned fragment: 44399893 to 44401377(NC_000020.11); relatively -1363 to +122, where +1 corresponds to 1 nt of NM_178849.2 + + [pdf]
HPGD RDB07457 pGL4-phHPGD cloned fragment: 174523666 to 174522440(NC_000004.12); relatively -1178 to +49, where +1 corresponds to 1 nt of NM_000860.6 + + 13.3 [pdf]
HSP90AB1 RDB07321 pGL4-phHSP90AB1 cloned fragment: 44245932 to 44247147(NC_000006.12); relatively -1026 to +190, where +1 corresponds to 1 nt of NM_001271969.1 503.5 560 596 [pdf]
HSPB1 RDB07530 pGL4-phHSPB1 cloned fragment: 76301177 to 76302661(NC_000007.14); relatively -1496 to -11, where +1 corresponds to 1 nt of NM_001540.5 27 56.3 ++ [pdf]
ICAM1 RDB07390 pGL4-phICAM1 cloned fragment: 10269837 to 10271163(NC_000019.10); relatively -1283 to +44, where +1 corresponds to 1 nt of NM_000201.3 17.5 ++ + [pdf]
ID2 RDB07306 pGL4-phID2 cloned fragment: 8680707 to 8682179(NC_000002.12); relatively -1349 to +124, where +1 corresponds to 1 nt of NM_002166.5 1140 316 2603.3 [pdf]
IFI16 RDB07372 pGL4-phIFI16 cloned fragment: 159008613 to 159009928(NC_000001.11); relatively -1279 to +37, where +1 corresponds to 1 nt of NM_001206567.1 ++ ++ 61.5 [pdf]
IFNG RDB07297 pGL4-phIFNG cloned fragment: 68160883 to 68159668(NC_000012.12); relatively -1142 to +74, where +1 corresponds to 1 nt of NM_000619.3 12 + 21 [pdf]
IFNGR1 RDB07708 pGL4-phIFNGR1 cloned fragment: 137220865 to 137219400(NC_000006.12); relatively -1435 to +31, where +1 corresponds to 1 nt of NM_000416.2 213 167.5 176.9 [pdf]
IGF2 RDB07727 pGL4-phIGF2 cloned fragment: 2140216 to 2138757(NC_000011.10); relatively -827 to +633, where +1 corresponds to 1 nt of NM_000612.6 and relatively -1242 to +218, where +1 corresponds to 1 nt of NM_000612.5 18 ++ + [pdf]
IGFBP3 RDB07568 pGL4-phIGFBP3 cloned fragment: 45922417 to 45921216(NC_000007.14); relatively -1145 to +57, where +1 corresponds to 1 nt of NM_001013398.2 119 49.5 22.2 [pdf]
IL1A RDB07682 pGL4-phIL1A cloned fragment: 112786862 to 112785369(NC_000002.12); relatively -1464 to +30, where +1 corresponds to 1 nt of NM_000575.4 [pdf]
IL2 RDB07391 pGL4-phIL2 cloned fragment: 122457684 to 122456439(NC_000004.12); relatively -1189 to +57, where +1 corresponds to 1 nt of NM_000586.3 [pdf]
IL2RA RDB07525 pGL4-phIL2RA cloned fragment: 6063761 to 6062289(NC_000010.11); relatively -1391 to +82, where +1 corresponds to 1 nt of NM_000417.2 [pdf]
IL5 RDB07392 pGL4-phIL5 cloned fragment: 132544758 to 132543482(NC_000005.10); relatively -1236 to +41, where +1 corresponds to 1 nt of NM_000879.3 [pdf]
IL6 RDB07313 pGL4-phIL6 cloned fragment: 22725956 to 22727254(NC_000007.14); relatively -1186 to +113, where +1 corresponds to 1 nt of NM_000600.4 94.5 ++ [pdf]
IL8 RDB07322 pGL4-phIL8 cloned fragment: 73739341 to 73740603(NC_000004.12); relatively -1165 to +98, where +1 corresponds to 1 nt of NM_000584.3 376.5 1675 568 [pdf]
INS RDB07387 pGL4-phINS cloned fragment: 2162444 to 2161182(NC_000011.10); relatively -1235 to +28, where +1 corresponds to 1 nt of NM_000207.3 + + ++ [pdf]
IRF3 RDB07821 pGL4-phIRF3 cloned fragment: 49667274 to 49665802(NC_000019.10); relatively -1417 to +56, where +1 corresponds to 1 nt of NM_001571.6 37 37 27.8 [pdf]
JUN RDB07298 pGL4-phJUN cloned fragment: 58785253 to 58784090(NC_000001.11); relatively -1206 to -42, where +1 corresponds to 1 nt of NM_002228.4 329.5 2332 770 [pdf]
KLK3 RDB07324 pGL4-phKLK3 cloned fragment: 50853756 to 50854937(NC_000019.10); relatively -1159 to +23, where +1 corresponds to 1 nt of NM_001648.2 + ++ ++ [pdf]
KLKB1 RDB07373 pGL4-phKLKB1 cloned fragment: 186226277 to 186227580(NC_000004.12); relatively -1194 to +110, where +1 corresponds to 1 nt of NM_000892.4 ++ ++ ++ [pdf]
LEF1 RDB07553 pGL4-phLEF1 cloned fragment: 108169899 to 108168395(NC_000004.12); relatively -967 to +538, where +1 corresponds to 1 nt of NM_016269.5 relatively -1477 to +28, where +1 corresponds to 1 nt of NM_016269.3 ++ + [pdf]
LEP RDB07688 pGL4-phLEP cloned fragment: 128239886 to 128241342(NC_000007.14 ); relatively -1392 to +65, where +1 corresponds to 1 nt of NM_000230.3 ++ + + [pdf]
LIF RDB07417 pGL4-phLIF cloned fragment: 30248070 to 30246767(NC_000022.11); relatively -1219 to +85, where +1 corresponds to 1 nt of NM_002309.4 ++ + + [pdf]
LTA RDB07486 pGL4-phLTA cloned fragment: 31570952 to 31572360(NC_000006.12 ); relatively -1147 to +262, where +1 corresponds to 1 nt of NM_001159740.2 [pdf]
MAD1L1 RDB07374 pGL4-phMAD1L1 cloned fragment: 2234298 to 2232920(NC_000007.14); relatively -1353 to +26, where +1 corresponds to 1 nt of NM_003550.3 472 450 901 [pdf]
MAT2A RDB07393 pGL4-phMAT2A cloned fragment: 85537937 to 85539213(NC_000002.12); relatively -1231 to +46, where +1 corresponds to 1 nt of NM_005911.6 237.5 247 381.5 [pdf]
MDM2 RDB07403 pGL4-phMDM2 cloned fragment: 68806988 to 68808306(NC_000012.12); relatively -1184 to +135, where +1 corresponds to 1 nt of NM_002392.5 ++ 48 30 [pdf]
MDM4 RDB07418 pGL4-phMDM4 cloned fragment: 204515095 to 204516413(NC_000001.11); relatively -1311 to +8, where +1 corresponds to 1 nt of NM_002393.5 669 885 475 [pdf]
MET RDB07554 pGL4-phMET cloned fragment: 116670988 to 116672444(NC_000007.14); relatively -1208 to +249, where +1 corresponds to 1 nt of NM_001127500.3 + + + [pdf]
MGP RDB07394 pGL4-phMGP cloned fragment: 14887086 to 14885795(NC_000012.12); relatively -1024 to +268, where +1 corresponds to 1 nt of NM_001190839.2 ++ [pdf]
MIF RDB07913 pGL4-phMIF cloned fragment: 23892945 to 23894404(NC_000022.11); relatively -1438 to +22, where +1 corresponds to 1 nt of NM_002415.2 40 34 50.8 [pdf]
MKI67 RDB07323 pGL4-phMKI67 cloned fragment: 128127561 to 128126143(NC_000010.11); relatively -1357 to +62, where +1 corresponds to 1 nt of NM_002417.4 60.5 153 46 [pdf]
MMP2 RDB07314 pGL4-phMMP2 cloned fragment: 55470229 to 55479221(NC_000016.10); relatively -8969 to +24, where +1 corresponds to 1 nt of NM_004530.6 + ++ ++ [pdf]
MMP3 RDB07535 pGL4-phMMP3 cloned fragment: 102844952 to 102843589(NC_000011.10); relatively -1343 to +21, where +1 corresponds to 1 nt of NM_002422.5 + 18.1 [pdf]
MMP7 RDB07536 pGL4-phMMP7 cloned fragment: 102532084 to 102530699(NC_000011.10); relatively -1337 to +49, where +1 corresponds to 1 nt of NM_002423.5 + [pdf]
MMP9 RDB07537 pGL4-phMMP9 cloned fragment: 46007674 to 46009018(NC_000020.11); relatively -1234 to +111, where +1 corresponds to 1 nt of NM_004994.3 ++ [pdf]
MT1A RDB07513 pGL4-phMT1A cloned fragment: 56634288 to 56638692(NC_000016.10); relatively -4378 to +27, where +1 corresponds to 1 nt of NM_005946.3 61.8 59.1 25.2 [pdf]
MYB RDB07480 pGL4-phMYB cloned fragment: 135179905 to 135181339(NC_000006.12 ); relatively -1410 to +25, where +1 corresponds to 1 nt of NM_001130173.1 ++ + 24.2 [pdf]
MYC RDB07325 pGL4-phMYC cloned fragment: 127734926 to 127736192(NC_000008.11); relatively -1305 to -38, where +1 corresponds to 1 nt of NM_002467.6 ++ ++ 10 [pdf]
MYCN RDB07820 pGL4-phMYCN cloned fragment: 15939093 to 15940561(NC_000002.12); relatively -1457 to +12, where +1 corresponds to 1 nt of NM_001293228.2 30 + ++ [pdf]
NFATC4 RDB07376 pGL4-phNFATC4 cloned fragment: 24366849 to 24368163(NC_000014.9); relatively -62 to +1253, where +1 corresponds to 1 nt of NM_001136022.2 and relatively -1335 to -20, where +1 corresponds to 1 nt of NM_004554.5 33 19 47 [pdf]
NFIC RDB07399 pGL4-phNFIC cloned fragment: 3365447 to 3366598(NC_000019.10); relatively -1136 to +16, where +1 corresponds to 1 nt of NM_001245002.2 53 26 59 [pdf]
NFKB2 RDB07478 pGL4-phNFKB2 cloned fragment: 102394401 to 102395722(NC_000010.11); relatively -177 to +1145, where +1 corresponds to 1 nt of NM_001077494.3 and relatively -941 to +381, where +1 corresponds to 1 nt of XM_017016278.1 718.8 83.5 44.5 [pdf]
NLRC4 RDB07406 pGL4-phNLRC4 cloned fragment: 32266994 to 32265677(NC_000002.12); relatively -1251 to +67, where +1 corresponds to 1 nt of NM_021209.4 + + [pdf]
NME1 RDB07326 pGL4-phNME1 cloned fragment: 51152418 to 51153660(NC_000017.11); relatively -1141 to +102, where +1 corresponds to 1 nt of NM_001018136.3 606.5 622 709 [pdf]
NOS2 RDB07377 pGL4-phNOS2 cloned fragment: 27801702 to 27800399(NC_000017.11); relatively -1173 to +131, where +1 corresponds to 1 nt of NM_000625.4 21 ++ 13 [pdf]
NQO1 RDB07570 pGL4-phNQO1 cloned fragment: 69727985 to 69726587(NC_000016.10); relatively -1355 to +44, where +1 corresponds to 1 nt of NM_000903.2 998.5 209.2 98.2 [pdf]
NR3C1 RDB07689 pGL4-phNR3C1 cloned fragment: 143404999 to 143403508(NC_000005.10); relatively -1313 to +179, where +1 corresponds to 1 nt of NM_001204258.2 13.7 + ++ [pdf]
NTS RDB07308 pGL4-phNTS cloned fragment: 85873118 to 85874330(NC_000012.12); relatively -1177 to +36, where +1 corresponds to 1 nt of NM_006183.5 138 38 303.3 [pdf]
PARP1 RDB07725 pGL4-phPARP1 cloned fragment: 226409429 to 226407965(NC_000001.11); relatively -1336 to +129, where +1 corresponds to 1 nt of NM_001618.4 67.5 56.5 79.6 [pdf]
PAX1 RDB07910 pGL4-phPAX1 cloned fragment: 21704218 to 21705707(NC_000020.11); relatively -1446 to +44, where +1 corresponds to 1 nt of NM_006192.5 24 + + [pdf]
PAX6 RDB07911 pGL4-phPAX6 cloned fragment: 31812790 to 31811331(NC_000011.10 ); relatively -1437 to +23, where +1 corresponds to 1 nt of NM_000280.4 ++ + [pdf]
PAX8 RDB07906 pGL4-phPAX8 cloned fragment: 113280371 to 113278890(NC_000002.12); relatively -1450 to +32, where +1 corresponds to 1 nt of NM_003466.4 ++ + [pdf]
PCNA RDB07365 pGL4-phPCNA cloned fragment: 5127783 to 5126581(NC_000020.11); relatively -1161 to +42, where +1 corresponds to 1 nt of NM_002592.2 50 46.8 214 [pdf]
PDHA1 RDB07514 pGL4-phPDHA1 cloned fragment: 19342523 to 19343977(NC_000023.11); relatively -1404 to +51, where +1 corresponds to 1 nt of NM_000284.4 262.3 274.9 140.1 [pdf]
PENK RDB07293 pGL4-phPENK cloned fragment: 56447221 to 56445951(NC_000008.11); relatively -580 to +691, where +1 corresponds to 1 nt of NM_001135690.3 11 ++ 40 [pdf]
PERP RDB07411 pGL4-phPERP cloned fragment: 138108796 to 138107329(NC_000006.12); relatively -1377 to +91, where +1 corresponds to 1 nt of NM_022121.5 ++ 12 ++ [pdf]
PGR RDB07809 pGL4-phPGR cloned fragment: 101131251 to 101129781(NC_000011.10); relatively -1438 to +33, where +1 corresponds to 1 nt of NM_000926.4 26 + ++ [pdf]
PLAT RDB07295 pGL4-phPLAT cloned fragment: 42208678 to 42207652(NC_000008.11); relatively -1113 to -86, where +1 corresponds to 1 nt of NM_000930.5 + + + [pdf]
PLAU RDB07487 pGL4-phPLAU cloned fragment: 73909783 to 73911185(NC_000010.11); relatively -1318 to +85, where +1 corresponds to 1 nt of NM_002658.4 + 20.5 + [pdf]
PLAUR RDB07312 pGL4-phPLAUR cloned fragment: 43671502 to 43670283(NC_000019.10); relatively -1157 to +63, where +1 corresponds to 1 nt of NM_002659.4 + + [pdf]
PLK1 RDB07327 pGL4-phPLK1 cloned fragment: 23677730 to 23678950(NC_000016.10); relatively -1042 to +179, where +1 corresponds to 1 nt of NM_005030.6 11 24 15 [pdf]
PML RDB07343 pGL4-phPML cloned fragment: 73993428 to 73994732(NC_000015.10); relatively -1245 to +60, where +1 corresponds to 1 nt of NM_033238.2 15.5 115 174 [pdf]
POLD1 RDB07344 pGL4-phPOLD1 cloned fragment: 50,383,082 – 50,384,389(NC_000019.10); relatively -1.2 kb to +67, where +1 corresponds to 1 nt of NM_001256849.1 200 145 238 [pdf]
POU5F1 RDB07912 pGL4-phPOU5F1 cloned fragment: 31172142 to 31170650(NC_000006.12); relatively -1460 to +33, where +1 corresponds to 1 nt of NM_002701.6 28.5 + + [pdf]
PPP1R15A RDB07307 pGL4-phPPP1R15A cloned fragment: 48871193 to 48872414(NC_000019.10); relatively -1199 to +23, where +1 corresponds to 1 nt of NM_014330.3 1042 626 6010 [pdf]
PPP2R4 RDB07294 pGL4-phPPP2R4 cloned fragment: 129109782 to 129110998(NC_000009.12); relatively -1532 to -315, where +1 corresponds to 1 nt of NM_178001.2 and relatively -1168 to +49, where +1 corresponds to 1 nt of XM_011518834.2 498 123 870 [pdf]
PRKAB1 RDB07328 pGL4-phPRKAB1 cloned fragment: 119666822 to 119667994(NC_000012.12); relatively -1311 to -138, where +1 corresponds to 1 nt of NM_006253.5 559.5 1031 702 [pdf]
PSAP RDB07515 pGL4-phPSAP cloned fragment: 71852680 to 71851263(NC_000010.11); relatively -1429 to -11, where +1 corresponds to 1 nt of NM_002778.4 219.6 268.4 133.1 [pdf]
PTEN RDB07400 pGL4-phPTEN cloned fragment: 87862065 to 87863506(NC_000010.11); relatively -1560 to -118, where +1 corresponds to 1 nt of NM_000314.7 + 75 ++ [pdf]
PTGS2 RDB07300 pGL4-phPTGS2 cloned fragment: 186681620 to 186680368(NC_000001.11); relatively -1197 to +56, where +1 corresponds to 1 nt of NM_000963.4 51.5 11 88 [pdf]
PTTG1 RDB07329 pGL4-phPTTG1 cloned fragment: 160420669 to 160421890(NC_000005.10); relatively -1193 to +29, where +1 corresponds to 1 nt of NM_001282382.1 43.5 14 29 [pdf]
RAD51 RDB07813 pGL4-phRAD51 cloned fragment: 40693865 to 40695330(NC_000015.10 ); relatively -1309 to +157, where +1 corresponds to 1 nt of NM_002875.5 41.5 12.3 12.8 [pdf]
RARB RDB07905 pGL4-phRARB cloned fragment: 25426903 to 25428365(NC_000003.12); relatively -1360 to +103, where +1 corresponds to 1 nt of NM_000965.4 ++ 27.3 13.4 [pdf]
RARG RDB07903 pGL4-phRARG cloned fragment: 53233642 to 53232176(NC_000012.12); relatively -1433 to +34, where +1 corresponds to 1 nt of NM_000966.6 14 + + [pdf]
RB1 RDB07345 pGL4-phRB1 cloned fragment: 48302465 to 48303797(NC_000013.11); relatively -1282 to +51, where +1 corresponds to 1 nt of NM_000321.2 175 375 526 [pdf]
REL RDB07481 pGL4-phREL cloned fragment: 60880227 to 60881664(NC_000002.12); relatively -1347 to +91, where +1 corresponds to 1 nt of NM_002908.4 39 30 24.8 [pdf]
RELA RDB07366 pGL4-phRELA cloned fragment: 65664031 to 65662883(NC_000011.10); relatively -1059 to +90, where +1 corresponds to 1 nt of NM_021975.3 136.8 73 399 [pdf]
RHOA RDB07404 pGL4-phRHOA cloned fragment: 49413224 to 49411909(NC_000003.12); relatively -1127 to +189, where +1 corresponds to 1 nt of NM_001664.4 258 296 422 [pdf]
RPRM RDB07409 pGL4-phRPRM cloned fragment: 153479948 to 153478648(NC_000002.12); relatively -1186 to +115, where +1 corresponds to 1 nt of NM_019845.3 13.5 31 25 [pdf]
RRM2B RDB07346 pGL4-phRRM2B cloned fragment: 102240355 to 102239033(NC_000008.11); relatively -1237 to +86, where +1 corresponds to 1 nt of NM_015713.4 ++ 24.3 72.5 [pdf]
SCO2 RDB07415 pGL4-phSCO2 cloned fragment: 50526812 to 50525498(NC_000022.11); relatively -1207 to +108, where +1 corresponds to 1 nt of NM_005138.2 333.5 660 124.5 [pdf]
SERPINE1 RDB07461 pGL4-phSERPINE1 cloned fragment: 101125677 to 101127125(NC_000007.14); relatively -1412 to +37, where +1 corresponds to 1 nt of NM_000602.4 234.5 127 33.5 [pdf]
SESN2 RDB07413 pGL4-phSESN2 cloned fragment: 28258366 to 28259686(NC_000001.11); relatively -1152 to +169, where +1 corresponds to 1 nt of NM_031459.5 759.5 64 519 [pdf]
SFN RDB07408 pGL4-phSFN cloned fragment: 26861812 to 26863163(NC_000001.11); relatively -1337 to +15, where +1 corresponds to 1 nt of NM_006142.5 49 105 158 [pdf]
SLC2A1 RDB07814 pGL4-phSLC2A1 cloned fragment: 42,960,401 to 42,959,101(NC_000001.11); relatively -1.2 kb to +76, where +1 corresponds to 1 nt of NM_006516.2 + + [pdf]
SMAD1 RDB07732 pGL4-phSMAD1 cloned fragment: 145480402 to 145481868(NC_000004.12); relatively -1451 to +16, where +1 corresponds to 1 nt of NM_005900.3 14.5 ++ ++ [pdf]
SMAD4 RDB07733 pGL4-phSMAD4 cloned fragment: 51028864 to 51030359(NC_000018.10); relatively -1349 to +147, where +1 corresponds to 1 nt of NM_005359.5 222 126.8 94.5 [pdf]
SOD1 RDB07686 pGL4-phSOD1 cloned fragment: 31658211 to 31659681(NC_000021.9); relatively -1411 to +60, where +1 corresponds to 1 nt of NM_000454.4 288.7 32 28.1 [pdf]
SP1 RDB07531 pGL4-phSP1 cloned fragment: 53378733 to 53380219(NC_000012.12); relatively -1443 to +44, where +1 corresponds to 1 nt of NM_138473.3 249.7 122 130.3 [pdf]
SP3 RDB07817 pGL4-phSP3 cloned fragment: 173966777 to 173965316(NC_000002.12); relatively -1075 to +387, where +1 corresponds to 1 nt of NM_003111.4 306.5 170.5 140.9 [pdf]
SPP1 RDB07552 pGL4-phSPP1 cloned fragment: 87974284 to 87975705(NC_000004.12); relatively -1366 to +56, where +1 corresponds to 1 nt of NM_001040058.1 + + + [pdf]
SSTR2 RDB07378 pGL4-phSSTR2 cloned fragment: 73163842 to 73165161(NC_000017.11); relatively -1168 to +152, where +1 corresponds to 1 nt of NM_001050.3 48 57 116 [pdf]
STAT1 RDB07405 pGL4-phSTAT1 cloned fragment: 191015482 to 191014170(NC_000002.12); relatively -1232 to +81, where +1 corresponds to 1 nt of NM_007315.3 46.5 198 103 [pdf]
STAT4 RDB07711 pGL4-phSTAT4 cloned fragment: 191152547 to 191151082(NC_000002.12 ); relatively -1553 to -87, where +1 corresponds to 1 nt of NM_003151.4 + [pdf]
TBXAS1 RDB07347 pGL4-phTBXAS1 cloned fragment: 139828033 to 139829353(NC_000007.14); relatively -1120 to +201, where +1 corresponds to 1 nt of NM_001061.4 ++ 46.3 25.5 [pdf]
TERT RDB07379 pGL4-phTERT cloned fragment: 1296353 to 1295013(NC_000005.10); relatively -1306 to +35, where +1 corresponds to 1 nt of NM_198253.2 76 27 90 [pdf]
TF RDB07540 pGL4-phTF cloned fragment: 133744949 to 133746426(NC_000003.12); relatively -1184 to +294, where +1 corresponds to 1 nt of NM_001063.3 ++ 35.8 ++ [pdf]
TFF1 RDB07511 pGL4-phTFF1 cloned fragment: 42367873 to 42366498(NC_000021.9); relatively -1338 to +38, where +1 corresponds to 1 nt of NM_003225.3 13.2 85 13.7 [pdf]
TG RDB07304 pGL4-phTG cloned fragment: 132865820 to 132866983(NC_000008.11); relatively -1138 to +26, where +1 corresponds to 1 nt of NM_003235.5 ++ + 30 [pdf]
TGFA RDB07348 pGL4-phTGFA cloned fragment: 70555154 to 70553850(NC_000002.12); relatively -1139 to +166, where +1 corresponds to 1 nt of NM_003236.3 23.3 36 124 [pdf]
TH RDB07301 pGL4-phTH cloned fragment: 2172941 to 2171785(NC_000011.10); relatively -1126 to +31, where +1 corresponds to 1 nt of NM_000360.4 68 14 66.7 [pdf]
THBS1 RDB07728 pGL4-phTHBS1 cloned fragment: 39579674 to 39581147(NC_000015.10); relatively -1405 to +69, where +1 corresponds to 1 nt of NM_003246.4 171.5 33.5 12.3 [pdf]
TIMP1 RDB07516 pGL4-phTIMP1 cloned fragment: 47581006 to 47582331(NC_000023.11); relatively -1430 to -104, where +1 corresponds to 1 nt of NM_003254.3 + + [pdf]
TNF RDB07310 pGL4-phTNF cloned fragment: 31574419 to 31575594(NC_000006.12); relatively -1146 to +30, where +1 corresponds to 1 nt of NM_000594.4 42 30 31 [pdf]
TNFRSF10B RDB07380 pGL4-phTNFRSF10B cloned fragment: 23070346 to 23069042(NC_000008.11); relatively -1315 to -10, where +1 corresponds to 1 nt of NM_003842.5 and relatively -1159 to +146, where +1 corresponds to 1 nt of NR_027140.1 40 65 228 [pdf]
TNFRSF10C RDB07375 pGL4-phTNFRSF10C cloned fragment: 23101691 to 23103016(NC_000008.11); relatively -1123 to +203, where +1 corresponds to 1 nt of NM_003841.4 16 ++ 13 [pdf]
TNFRSF11B RDB07533 pGL4-phTNFRSF11B cloned fragment: 118953586 to 118952112(NC_000008.11); relatively -1701 to -226, where +1 corresponds to 1 nt of NM_002546.4 + + [pdf]
TNFSF10 RDB07526 pGL4-phTNFSF10 cloned fragment: 172524885 to 172523419(NC_000003.12); relatively -1455 to +12, where +1 corresponds to 1 nt of NM_003810.4 16.5 ++ + [pdf]
TNNC1 RDB07517 pGL4-phTNNC1 cloned fragment: 52455364 to 52453996(NC_000003.12); relatively -1323 to +46, where +1 corresponds to 1 nt of NM_003280.3 ++ + [pdf]
TP53 RDB07330 pGL4-phTP53 cloned fragment: 7688691 to 7687505(NC_000017.11); relatively -1141 to +46, where +1 corresponds to 1 nt of NM_000546.5 56 93 133 [pdf]
TP53AIP1 RDB07410 pGL4-phTP53AIP1 cloned fragment: 128944146 to 128942842(NC_000011.10); relatively -747 to +558, where +1 corresponds to 1 nt of NM_022112.2 + 14 13 [pdf]
TP53TG5 RDB07336 pGL4-phTP53TG5 cloned fragment: 45379557 to 45378288(NC_000020.11); relatively -1232 to +38, where +1 corresponds to 1 nt of NM_014477.3 + [pdf]
TP63 RDB07350 pGL4-phTP63 cloned fragment: 189630170 to 189631499(NC_000003.12); relatively -1219 to +111, where +1 corresponds to 1 nt of NM_003722.5 ++ + 72.5 [pdf]
TP73 RDB07381 pGL4-phTP73 cloned fragment: 3651265 to 3652596(NC_000001.11); relatively -1251 to +81, where +1 corresponds to 1 nt of NM_005427.4 10 14 41 [pdf]
TRIM22 RDB07382 pGL4-phTRIM22 cloned fragment: 5688478 to 5689794(NC_000011.10); relatively -1109 to +208, where +1 corresponds to 1 nt of NM_006074.4 ++ + + [pdf]
TTR RDB07815 pGL4-phTTR cloned fragment: 31590468 to 31591928(NC_000018.10); relatively -1299 to +162, where +1 corresponds to 1 nt of NM_000371.3 10 88 22.6 [pdf]
TXN RDB07518 pGL4-phTXN cloned fragment: 110257849 to 110256478(NC_000009.12); relatively -1209 to +163, where +1 corresponds to 1 nt of NM_003329.3 1676.1 197.3 95.2 [pdf]
VCAN RDB07339 pGL4-phVCAN cloned fragment: 83470557 to 83471742(NC_000005.10); relatively -1117 to +69, where +1 corresponds to 1 nt of NM_004385.4 + [pdf]
VEGFA RDB07681 pGL4-phVEGFA cloned fragment: 43769068 to 43770372(NC_000006.12); relatively -1141 to +164, where +1 corresponds to 1 nt of NM_001025366.2 125.5 27 20.7 [pdf]
WRN RDB07569 pGL4-phWRN cloned fragment: 31032123 to 31033442(NC_000008.11); relatively -1139 to +181, where +1 corresponds to 1 nt of NM_000553.5 + [pdf]
WT1 RDB07822 pGL4-phWT1 cloned fragment: 32436802 to 32435337(NC_000011.10 ); relatively -1263 to +203, where +1 corresponds to 1 nt of NM_000378.6 ++ [pdf]
XPC RDB07351 pGL4-phXPC cloned fragment: 14179875 to 14178575(NC_000003.12); relatively -1203 to +98, where +1 corresponds to 1 nt of NM_004628.4 141 341.8 482.5 [pdf]

go to Head


(GRP0033e 2011.01.27 T.M.)

2023.06.08



Comments are closed.