Genome Network Project Human cDNA Clone
The RIKEN BioResource Research Center (BRC) is distributing copies of full-length human cDNA clones, produced and organized through the MEXT Genome Network Project to academia under its distribution policy.
There are two types of cDNA clone collections.
1) Human Full-Length cDNA clones
Approximately 30,000 clones corresponding to 60% of all human genes (14,000 genes) produced and organized by Dr. Sumio Sugano of the University of Tokyo and Dr. Yoshihide Hayashizaki of RIKEN OSC.
2) Human Gateway® Entry clones
Approximately 50,000 clones corresponding to 6,300 genes produced by cloning PCR-amplified open reading frame (ORF) fragments from the human full-length cDNA clones and studied through the government-supported MEXT Genome Network Project. DNA fragments cloned into Gateway® entry clones can be transferred into one or more destination vectors simultaneously using Gateway® technology. The Gateway® Entry clones include clones made from cDNA created by the Research Association for Biotechnology (RAB) under the New Energy and Industrial Technology Development Organization (NEDO) Full-length Human cDNA Sequencing Project.
Results of the project attained using the Genome Network Project cDNA clones have appeared in journals including Nature Genetics. Detailed information on these clones is available via the Genome Network Platform.
References:
The papers describing these libraries have been published in journals indicated below:
- Ota T. et al., Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36: 40-45, 2004.
- Otsuki T. et al., Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. DNA Res., 12: 117-126, 2005.
- Kimura K. et al., Diversification of transcriptional modulation: Large-scale identification and characterization of putative alternative promoters of human genes. Genome Res., 16: 55-65, 2006.
- Itoh M., Yasunishi A., Imamura K., Kanamori M., Suzuki H., Suzuki M., Carninci P., Kawai J., Hayashizaki Y. Constructing ORFeome resources with removable termination codons, Biotechniques, 41: 44-48, 2006.
- For more information about Gateway® technology, please visit the website of Invitrogen.
- Gateway® is a registered trademark of Invitrogen.
- Please visit the website of the Biological Resource Center (NBRC) at the National Institute of Technology and Evaluation (NITE) for more information about cDNA of the NEDO Full-length Human cDNA Sequencing Project.
- Please visit Japan Biological Informatics Consortium (JBIC) regarding the NEDO Full-length Human cDNA provided by NITE.
Please visit Informaion site for articles published by using this materials, references and tips.
Please reffer Data Sheet for sequence primers.
Clone search
- Key word search
- Browsing A to Z list
Search your interesting gene by browsing A to Z list sorted by locus symbol.
Ordering Genome Network Project Clones
in Japanese
The BIOLOGICAL RESOURCE is provided only for academic research in the non-profit organization.
Forms
Order Form
Order Form: Please complete the form with your shipping information including your account number of an international courier (FedEx. World Courier, TNT Express, DHL Global Forwarding and others). See detail in Information of Request for Distribution Note: The resident of the European Economic Area (EEA) and China, please read Special distribution Information to Residents of the Foreign Countries |
Order Form for Credit Card Payment. (Visa or Master Card only) [Word] |
Order Form for Bank Transfer Payment. [Word] |
Material Transfer Agreement (MTA)
Forms | Description |
Material Transfer Agreement [Docx] (For use for not-for-profit academic purpose) | For the use of our bioresource in research for not-for-profit academic purpose by a non-profit organization.
|
Limited Use Label License: No.19 (Gateway® Cloning Products) pdf | Please refer Revision of Licensing Fee Equivalent for the Distribution of Bioresources Utilizing Gateway® Technology [link] and read the Ordering Form and Label License No. 19. |
Address for orders
Please complete one copy of Order Form and two copies of MTA and send them to the Gene Engineering Division by e-mail or post.
We look forward to receiving your order.
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Distribution Fees
Distribution fee per clone (as of April 1st, 2023): JPY 9,460 (For use in research for not-for-profit academic purpose).
|
In the case of Gateway® Expression Clone (pCMV SPORT6 and related vectors), users are asked to pay BRC an additional JPY 2,090 per clone that includes the license fee, handling of currency exchange, money transfer and other expense. (Please refer Revision of Licensing Fee Equivalent for the Distribution of Bioresources Utilizing Gateway® Technology [link])
Payment and charges
An INVOICE will be sent to you or your designated billing address. Prompt payment will be most appreciated. Please refer to the following page for more details: Information of Request for Distribution
RIKEN requests all applicants to cover all bank charges, (including exchange, commission and handling fees) incurred in sending payment for resources you have ordered.
Shipment
Form:
DNA solution with TE buffer (approx. 1 microgram) per clone.
Remarks:
Terminal nucleotide sequences of cDNA are checked prior to delivery.
Please allow 2 weeks before shipment.
Terms and Conditions for distribution
- In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of literatures designated by the Research Association for Biotechnology, Dr. Yoshihide Hayashizaki and Dr. Sumio Sugano is requested.:
- Ota T. et al., Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36: 40-45, 2004.
- Otsuki T. et al., Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. DNA Res., 12: 117-126, 2005.
- Kimura K. et al., Diversification of transcriptional modulation: Large-scale identification and characterization of putative alternative promoters of human genes. Genome Res., 16: 55-65, 2006.
- Itoh M., Yasunishi A., Imamura K., Kanamori M., Suzuki H., Suzuki M., Carninci P., Kawai J., Hayashizaki Y. Constructing ORFeome resources with removable termination codons, Biotechniques, 41: 44-48, 2006.
- In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the Research Association for Biotechnology, Dr. Yoshihide Hayashizaki of RIKEN and Dr. Sumio Sugano of Tokyo University is requested.
- The Research Association for Biotechnology does not warrant that the use of the BIOLOGICAL RESOURCE by the RECIPIENT will not infringe any patent, copyright, trademark or other intellectual property rights of third parties.
- The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization.
Contact information
If you have any questions regarding our DNA resources or related matters, please feel free to contact the Gene Engineering Division.
To contact us
The DNA Bank, RIKEN BioResource Research Center (BRC), 3-1-1 Koyadai, Tsukuba, Ibaraki 305-0074, Japan E-mail: dna_sec.brc@riken.jp FAX: (+81)-29-836-9120 |
Data Sheet
Primers for sequencing vectors
Vectors | Primers |
---|---|
pBluescriptR | Insert 5′: T7 (Pr0202) GTAATACGACTCACTATAGGGC Insert 3′: Reverse2 (Pr0100) GCGGATAACAATTTCACACAGG |
pCMV-SPORT6 | Insert 5′: Reverse2 (Pr0100) GCGGATAACAATTTCACACAGG Insert 3′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Upstream of poly(A): TTTTTTTTTTTTTTTTTTTTVNN (V: mixture of A,G and C) |
pCMV-SPORT6.1 | Insert 5′: Reverse2 (Pr0100) GCGGATAACAATTTCACACAGG Insert 3′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Upstream of poly(A): TTTTTTTTTTTTTTTTTTTTVNN (V: mixture of A,G and C) |
pCMV-SPORT6.ccdb | Insert 5′: Reverse2 (Pr0100) GCGGATAACAATTTCACACAGG Insert 3′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Upstream of poly(A): TTTTTTTTTTTTTTTTTTTTVNN (V: mixture of A,G and C) |
pCR4-TOPO | Insert 5′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Insert 3′: Reverse2 (Pr0100) GCGGATAACAATTTCACACAGG |
pDONR221 | Insert 5′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Insert 3′:T7long (Pr0244) CGCCAAGCTCTAATACGACTCACTATAGGG |
pDNR-Dual | Insert 5′:T7long (Pr0244) CGCCAAGCTCTAATACGACTCACTATAGGG Insert 3′:Dual-R (Pr0072) ATCCAAGCACTAGTCATGAC |
pDNR-LIB | Insert 5′:T7long (Pr0244) CGCCAAGCTCTAATACGACTCACTATAGGG Insert 3′: M13 Reverse (Pr0042) AAACAGCTATGACCATGTTCA |
pENTR/D-TOPO | Insert 5′: M13_-40 (Pr0410) GTTTTCCCAGTCACGACGTTGTA Insert 3′:T7long (Pr0244) CGCCAAGCTCTAATACGACTCACTATAGGG |
pOTB7 (pBR322 ori) | Insert 5′: pOTB7_F (Pr0224) AACGCGGCTACAATTAATACATAACC Insert 3′: pOTB7_R (Pr0225) GTACTGCAGCCGATTCATTAATGC Upstream of poly(A): TTTTTTTTTTTTTTTTTTTTVNN (V: mixture of A,G and C) |
(GRP0032e 2010.12.02 T.M.)
2024.03.14